Incidental Mutation 'R3715:Tdrd12'
ID259846
Institutional Source Beutler Lab
Gene Symbol Tdrd12
Ensembl Gene ENSMUSG00000030491
Gene Nametudor domain containing 12
SynonymsEG434165, 2410070K17Rik, ecat8, 2410004F06Rik, G1-476-14, repro23
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35469098-35537745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35504980 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 235 (E235G)
Ref Sequence ENSEMBL: ENSMUSP00000145609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032701] [ENSMUST00000127472] [ENSMUST00000187190] [ENSMUST00000193633] [ENSMUST00000205407] [ENSMUST00000206641]
Predicted Effect probably benign
Transcript: ENSMUST00000032701
AA Change: E288G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032701
Gene: ENSMUSG00000030491
AA Change: E288G

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127472
SMART Domains Protein: ENSMUSP00000118671
Gene: ENSMUSG00000030491

DomainStartEndE-ValueType
Pfam:TUDOR 3 76 6.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187190
AA Change: E288G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140328
Gene: ENSMUSG00000030491
AA Change: E288G

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 5.1e-24 PFAM
Pfam:DEAD 276 581 1.8e-6 PFAM
Pfam:TUDOR 852 973 4.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193633
AA Change: E288G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141796
Gene: ENSMUSG00000030491
AA Change: E288G

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 2.7e-24 PFAM
Pfam:DEAD 273 606 7.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205407
AA Change: E235G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000206641
AA Change: E10G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous males are infertile with small testes. Spermatogenesis is arrested predominantly at the pachytene spermatocyte stage. Retrotransposon hopping is derepressed in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Tdrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Tdrd12 APN 7 35505034 missense possibly damaging 0.95
IGL01879:Tdrd12 APN 7 35521923 missense probably damaging 1.00
IGL02026:Tdrd12 APN 7 35504233 splice site probably benign
IGL02186:Tdrd12 APN 7 35501401 missense probably damaging 0.99
PIT4131001:Tdrd12 UTSW 7 35481103 nonsense probably null
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0098:Tdrd12 UTSW 7 35475993 missense probably damaging 1.00
R0366:Tdrd12 UTSW 7 35508802 missense probably benign 0.25
R2050:Tdrd12 UTSW 7 35529247 missense probably damaging 0.98
R2851:Tdrd12 UTSW 7 35485373 missense probably damaging 1.00
R3859:Tdrd12 UTSW 7 35493820 missense possibly damaging 0.50
R3912:Tdrd12 UTSW 7 35487713 missense probably damaging 1.00
R4656:Tdrd12 UTSW 7 35485254 missense probably damaging 1.00
R4826:Tdrd12 UTSW 7 35504157 missense probably benign 0.00
R4969:Tdrd12 UTSW 7 35487295 splice site probably null
R5202:Tdrd12 UTSW 7 35490030 missense possibly damaging 0.49
R5321:Tdrd12 UTSW 7 35478094 missense probably damaging 1.00
R5642:Tdrd12 UTSW 7 35511300 missense probably damaging 0.99
R5709:Tdrd12 UTSW 7 35476053 missense probably damaging 1.00
R5835:Tdrd12 UTSW 7 35529264 missense probably damaging 1.00
R6029:Tdrd12 UTSW 7 35485230 missense probably damaging 0.98
R6101:Tdrd12 UTSW 7 35481133 nonsense probably null
R6341:Tdrd12 UTSW 7 35490048 missense probably damaging 1.00
R6631:Tdrd12 UTSW 7 35485229 missense probably damaging 0.99
R6939:Tdrd12 UTSW 7 35485599 critical splice donor site probably null
R7032:Tdrd12 UTSW 7 35481046 nonsense probably null
R7058:Tdrd12 UTSW 7 35478109 missense unknown
R7096:Tdrd12 UTSW 7 35487589 missense
R7203:Tdrd12 UTSW 7 35489223 nonsense probably null
R7229:Tdrd12 UTSW 7 35480280 missense unknown
R7265:Tdrd12 UTSW 7 35487722 missense
R7284:Tdrd12 UTSW 7 35480136 splice site probably null
R7347:Tdrd12 UTSW 7 35485692 missense
R7501:Tdrd12 UTSW 7 35478091 missense unknown
R7789:Tdrd12 UTSW 7 35488692 missense
Predicted Primers PCR Primer
(F):5'- GTCCAGACAGTGAGCGAG -3'
(R):5'- TCTTGTATTGAATCTGTATGACAGTG -3'

Sequencing Primer
(F):5'- GCACAGGCTAGGTTACTACTC -3'
(R):5'- AGCTCTAAACTATAAGGATTCC -3'
Posted On2015-01-23