Incidental Mutation 'R3715:Stox2'
ID259853
Institutional Source Beutler Lab
Gene Symbol Stox2
Ensembl Gene ENSMUSG00000038143
Gene Namestorkhead box 2
Synonyms
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location47180048-47446362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47413152 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 52 (I52F)
Ref Sequence ENSEMBL: ENSMUSP00000148776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000211882]
Predicted Effect unknown
Transcript: ENSMUST00000074466
AA Change: D8E
SMART Domains Protein: ENSMUSP00000074064
Gene: ENSMUSG00000060559
AA Change: D8E

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
low complexity region 110 128 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181417
Predicted Effect possibly damaging
Transcript: ENSMUST00000211882
AA Change: I52F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Storkhead-box_winged-helix domain containing protein. This protein is differentially expressed in decidual tissue and may be involved in the susceptibility to pre-eclampsia with fetal growth restriction. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Stox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Stox2 APN 8 47193612 missense probably damaging 1.00
IGL02331:Stox2 APN 8 47191944 missense probably damaging 0.96
IGL02399:Stox2 APN 8 47186538 missense probably damaging 0.99
IGL03091:Stox2 APN 8 47193187 missense possibly damaging 0.66
IGL03143:Stox2 APN 8 47193804 missense possibly damaging 0.78
IGL03307:Stox2 APN 8 47194030 missense probably damaging 1.00
R0082:Stox2 UTSW 8 47203282 splice site probably benign
R0313:Stox2 UTSW 8 47192134 missense probably damaging 1.00
R0382:Stox2 UTSW 8 47203284 splice site probably benign
R0513:Stox2 UTSW 8 47193865 missense probably damaging 1.00
R0539:Stox2 UTSW 8 47194035 missense probably damaging 0.97
R0920:Stox2 UTSW 8 47193018 missense probably damaging 1.00
R1764:Stox2 UTSW 8 47194016 nonsense probably null
R1923:Stox2 UTSW 8 47193626 missense probably damaging 1.00
R2311:Stox2 UTSW 8 47191978 missense probably damaging 1.00
R3196:Stox2 UTSW 8 47192830 missense probably damaging 0.99
R4300:Stox2 UTSW 8 47193992 nonsense probably null
R4534:Stox2 UTSW 8 47193379 missense probably damaging 1.00
R4600:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4601:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4602:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4603:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4610:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4624:Stox2 UTSW 8 47193816 missense probably damaging 1.00
R4672:Stox2 UTSW 8 47192106 missense probably damaging 1.00
R4888:Stox2 UTSW 8 47203163 missense probably damaging 1.00
R4944:Stox2 UTSW 8 47413265 missense possibly damaging 0.46
R5331:Stox2 UTSW 8 47413627 utr 5 prime probably benign
R5349:Stox2 UTSW 8 47287916 missense possibly damaging 0.70
R5367:Stox2 UTSW 8 47203225 missense probably damaging 1.00
R5471:Stox2 UTSW 8 47193513 missense probably damaging 0.96
R5561:Stox2 UTSW 8 47193006 missense probably damaging 1.00
R5630:Stox2 UTSW 8 47191890 missense probably damaging 1.00
R5719:Stox2 UTSW 8 47413137 nonsense probably null
R5733:Stox2 UTSW 8 47413137 nonsense probably null
R5996:Stox2 UTSW 8 47203147 missense possibly damaging 0.93
R6170:Stox2 UTSW 8 47192020 missense probably benign 0.02
R6458:Stox2 UTSW 8 47192044 missense possibly damaging 0.66
R6786:Stox2 UTSW 8 47186465 missense probably damaging 1.00
R6815:Stox2 UTSW 8 47193101 missense probably damaging 1.00
R6951:Stox2 UTSW 8 47203132 missense probably damaging 1.00
R7193:Stox2 UTSW 8 47186454 missense probably benign
R7330:Stox2 UTSW 8 47192236 missense possibly damaging 0.61
R7552:Stox2 UTSW 8 47203119 critical splice donor site probably null
R8001:Stox2 UTSW 8 47186477 missense probably benign 0.06
X0027:Stox2 UTSW 8 47193840 missense possibly damaging 0.95
Z1177:Stox2 UTSW 8 47194050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCAAGTGCCCTAAAGTCCC -3'
(R):5'- CGATGCCTGGTTAAGATGGAG -3'

Sequencing Primer
(F):5'- TCACCCAAGCAGCGGATCTG -3'
(R):5'- AGAAGTTTCTGCAGATCGCGC -3'
Posted On2015-01-23