Incidental Mutation 'R3715:Elavl3'
ID259855
Institutional Source Beutler Lab
Gene Symbol Elavl3
Ensembl Gene ENSMUSG00000003410
Gene NameELAV like RNA binding protein 3
Synonyms2600009P04Rik, Huc, mHuC
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22015005-22052023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22018599 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 336 (D336E)
Ref Sequence ENSEMBL: ENSMUSP00000003501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003493] [ENSMUST00000003501] [ENSMUST00000115331] [ENSMUST00000215901] [ENSMUST00000216344]
PDB Structure
SOLUTION STRUCTURE OF THE FIRST RNA-BINDING DOMAIN (RBD1) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE SECOND RNA-BINDING DOMAIN (RBD2) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE HUC RBD1-RBD2 COMPLEXED WITH THE AU-RICH ELEMENT [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000003493
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003501
AA Change: D336E

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410
AA Change: D336E

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115331
SMART Domains Protein: ENSMUSP00000110987
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 1.7e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 215 236 3.2e-5 PFAM
Pfam:EF-hand_5 239 257 1.2e-3 PFAM
low complexity region 290 352 N/A INTRINSIC
Pfam:PRKCSH_1 373 519 4.4e-23 PFAM
Pfam:PRKCSH 413 471 4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213700
Predicted Effect probably benign
Transcript: ENSMUST00000215901
Predicted Effect probably benign
Transcript: ENSMUST00000216344
Meta Mutation Damage Score 0.0962 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain-specific preweaning lethality, abnormal cortical hypersynchronization and non-convulsive electropgraphic seizure. Mice heterozygous for the allele exhibit abnormal brain wave pattern and spike wave discharge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Elavl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Elavl3 APN 9 22036718 missense probably damaging 1.00
IGL02740:Elavl3 APN 9 22036379 missense probably benign 0.06
IGL03011:Elavl3 APN 9 22036316 missense probably damaging 1.00
IGL03211:Elavl3 APN 9 22018678 missense probably damaging 1.00
R0022:Elavl3 UTSW 9 22036871 splice site probably benign
R0105:Elavl3 UTSW 9 22036833 missense possibly damaging 0.84
R0850:Elavl3 UTSW 9 22036763 missense probably damaging 0.96
R1496:Elavl3 UTSW 9 22026165 splice site probably benign
R1499:Elavl3 UTSW 9 22018579 missense probably damaging 0.97
R3500:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3714:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3937:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3938:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R4791:Elavl3 UTSW 9 22024678 missense probably damaging 0.99
R4856:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4886:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4962:Elavl3 UTSW 9 22036811 missense probably benign 0.06
R5526:Elavl3 UTSW 9 22036326 missense probably benign
R5643:Elavl3 UTSW 9 22018733 missense probably benign 0.12
R6593:Elavl3 UTSW 9 22018547 missense possibly damaging 0.58
R7102:Elavl3 UTSW 9 22018729 missense possibly damaging 0.72
R7897:Elavl3 UTSW 9 22018550 missense probably damaging 1.00
R7980:Elavl3 UTSW 9 22018550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTGGTGTTTATGCAG -3'
(R):5'- AAAGTAGTCCCCTGTCGCTCATC -3'

Sequencing Primer
(F):5'- TCGAGATTGCGCACACTC -3'
(R):5'- CCATCGATGGCATGAGTGG -3'
Posted On2015-01-23