Incidental Mutation 'R3715:Hcn4'
ID259857
Institutional Source Beutler Lab
Gene Symbol Hcn4
Ensembl Gene ENSMUSG00000032338
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 4
Synonyms
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58823412-58863175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58844036 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 315 (R315H)
Ref Sequence ENSEMBL: ENSMUSP00000034889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034889]
Predicted Effect unknown
Transcript: ENSMUST00000034889
AA Change: R315H
SMART Domains Protein: ENSMUSP00000034889
Gene: ENSMUSG00000032338
AA Change: R315H

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 97 120 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
Pfam:Ion_trans_N 218 261 1.2e-23 PFAM
Pfam:Ion_trans 262 525 2.2e-25 PFAM
low complexity region 526 537 N/A INTRINSIC
Blast:cNMP 538 570 9e-13 BLAST
cNMP 595 708 2.27e-23 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 808 818 N/A INTRINSIC
low complexity region 831 856 N/A INTRINSIC
low complexity region 866 906 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 931 956 N/A INTRINSIC
low complexity region 960 987 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
low complexity region 1021 1036 N/A INTRINSIC
low complexity region 1045 1073 N/A INTRINSIC
low complexity region 1123 1140 N/A INTRINSIC
low complexity region 1154 1164 N/A INTRINSIC
Meta Mutation Damage Score 0.5982 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience embryonic lethality between E9.5 and E11.5. Conditional deletion in cardiac tissue results in severe bradycardia and death. Mice over-expressing the gene exhibit impaired firing rate in ORN, small olfactory bulb and reduced glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Hcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hcn4 APN 9 58860053 missense unknown
IGL00939:Hcn4 APN 9 58843927 missense probably benign 0.39
IGL01154:Hcn4 APN 9 58859079 missense unknown
IGL01408:Hcn4 APN 9 58859886 missense unknown
IGL02658:Hcn4 APN 9 58859465 missense unknown
IGL02877:Hcn4 APN 9 58859167 missense unknown
IGL03211:Hcn4 APN 9 58858151 missense unknown
PIT1430001:Hcn4 UTSW 9 58859550 missense unknown
R0049:Hcn4 UTSW 9 58860299 missense probably damaging 0.98
R0268:Hcn4 UTSW 9 58860162 missense unknown
R0812:Hcn4 UTSW 9 58823512 start codon destroyed probably null
R2121:Hcn4 UTSW 9 58824058 missense unknown
R3035:Hcn4 UTSW 9 58823680 missense unknown
R3737:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R3958:Hcn4 UTSW 9 58844048 missense unknown
R4035:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R4393:Hcn4 UTSW 9 58844300 missense unknown
R4418:Hcn4 UTSW 9 58843895 missense probably benign 0.39
R4532:Hcn4 UTSW 9 58857798 missense unknown
R4765:Hcn4 UTSW 9 58857977 missense unknown
R4857:Hcn4 UTSW 9 58859570 missense unknown
R4967:Hcn4 UTSW 9 58859828 missense unknown
R5068:Hcn4 UTSW 9 58860021 missense unknown
R5253:Hcn4 UTSW 9 58824275 missense unknown
R5304:Hcn4 UTSW 9 58843932 missense probably benign 0.39
R5600:Hcn4 UTSW 9 58859293 splice site probably null
R6346:Hcn4 UTSW 9 58859044 missense unknown
R6575:Hcn4 UTSW 9 58824152 missense unknown
R6622:Hcn4 UTSW 9 58857727 missense unknown
R6967:Hcn4 UTSW 9 58823945 missense unknown
R7038:Hcn4 UTSW 9 58823584 missense unknown
R7054:Hcn4 UTSW 9 58855717 missense unknown
R7229:Hcn4 UTSW 9 58853399 missense unknown
R7407:Hcn4 UTSW 9 58859370 missense unknown
R7448:Hcn4 UTSW 9 58844299 missense unknown
R7531:Hcn4 UTSW 9 58860137 missense unknown
R7572:Hcn4 UTSW 9 58823780 missense unknown
R7680:Hcn4 UTSW 9 58860671 missense probably benign 0.08
R7915:Hcn4 UTSW 9 58823935 missense unknown
R7956:Hcn4 UTSW 9 58844173 missense unknown
R8146:Hcn4 UTSW 9 58823744 missense unknown
R8234:Hcn4 UTSW 9 58844150 missense unknown
R8421:Hcn4 UTSW 9 58858096 missense unknown
R8690:Hcn4 UTSW 9 58843910 missense probably benign 0.39
R8855:Hcn4 UTSW 9 58858104 missense unknown
RF011:Hcn4 UTSW 9 58859915 missense unknown
X0009:Hcn4 UTSW 9 58860759 nonsense probably null
X0057:Hcn4 UTSW 9 58859368 missense unknown
Z1176:Hcn4 UTSW 9 58858148 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGTCCTCAGATTCTCCCCTG -3'
(R):5'- TAGCGGTTTTGTAGACCTCCG -3'

Sequencing Primer
(F):5'- GACTTCTTTGTCACTCTGGGCAG -3'
(R):5'- TTGTAGACCTCCGAGTCAATGCG -3'
Posted On2015-01-23