Incidental Mutation 'R3715:Syncrip'
ID259858
Institutional Source Beutler Lab
Gene Symbol Syncrip
Ensembl Gene ENSMUSG00000032423
Gene Namesynaptotagmin binding, cytoplasmic RNA interacting protein
SynonymshnRNP Q, GRY-RBP, Nsap1, pp68, RRM RNA binding protein GRY-RBP, Nsap1l, 2610109K23Rik, 4632417O19Rik
MMRRC Submission 040708-MU
Accession Numbers

Genbank: NM_019666NM_019796; MGI: 1891690

 

Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location88447009-88482574 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 88479685 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069221] [ENSMUST00000172508] [ENSMUST00000172828] [ENSMUST00000173405] [ENSMUST00000173801] [ENSMUST00000174269] [ENSMUST00000174282] [ENSMUST00000174361] [ENSMUST00000174391] [ENSMUST00000174688]
Predicted Effect probably benign
Transcript: ENSMUST00000069221
SMART Domains Protein: ENSMUSP00000063744
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 321 2.1e-8 SMART
RRM 339 404 1.4e-18 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172508
Predicted Effect probably benign
Transcript: ENSMUST00000172828
Predicted Effect probably benign
Transcript: ENSMUST00000173405
SMART Domains Protein: ENSMUSP00000133343
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
SCOP:d1l3ka1 156 196 5e-8 SMART
Blast:RRM 163 196 5e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173801
SMART Domains Protein: ENSMUSP00000133649
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 321 2.1e-8 SMART
RRM 339 404 1.4e-18 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 563 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174145
Predicted Effect probably benign
Transcript: ENSMUST00000174269
SMART Domains Protein: ENSMUSP00000134506
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 303 2.77e0 SMART
RRM 304 369 1.4e-18 SMART
low complexity region 393 455 N/A INTRINSIC
low complexity region 459 487 N/A INTRINSIC
low complexity region 491 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174282
SMART Domains Protein: ENSMUSP00000134071
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 1.4e-23 SMART
RRM 244 321 9.1e-11 SMART
RRM 339 404 6e-21 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174361
SMART Domains Protein: ENSMUSP00000134722
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 303 2.77e0 SMART
RRM 304 369 1.4e-18 SMART
low complexity region 393 455 N/A INTRINSIC
low complexity region 459 487 N/A INTRINSIC
low complexity region 491 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174391
SMART Domains Protein: ENSMUSP00000134342
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 65 139 3.38e-21 SMART
RRM 146 223 2.1e-8 SMART
RRM 241 306 1.4e-18 SMART
low complexity region 330 392 N/A INTRINSIC
low complexity region 396 424 N/A INTRINSIC
low complexity region 428 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174688
SMART Domains Protein: ENSMUSP00000133716
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 224 3.18e-8 SMART
RRM 225 290 1.4e-18 SMART
low complexity region 314 376 N/A INTRINSIC
low complexity region 380 408 N/A INTRINSIC
low complexity region 412 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187770
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cellular heterogeneous nuclear ribonucleoprotein (hnRNP) family. hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA (hnRNA) and regulate alternative splicing, polyadenylation, and other aspects of mRNA metabolism and transport. The encoded protein plays a role in multiple aspects of mRNA maturation and is associated with several multiprotein complexes including the apoB RNA editing-complex and survival of motor neurons (SMN) complex. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 20. [provided by RefSeq, Dec 2011]
Allele List at MGI

 All alleles(28) : Gene trapped(28)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Syncrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Syncrip APN 9 88456607 utr 3 prime probably benign
IGL01474:Syncrip APN 9 88480747 missense probably benign 0.04
IGL02657:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02659:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02660:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02699:Syncrip APN 9 88456554 utr 3 prime probably benign
IGL02727:Syncrip APN 9 88479879 missense probably damaging 1.00
IGL02801:Syncrip APN 9 88479809 missense probably damaging 1.00
IGL03169:Syncrip APN 9 88456443 utr 3 prime probably benign
IGL03214:Syncrip APN 9 88464643 intron probably benign
3-1:Syncrip UTSW 9 88461674 nonsense probably null
R0426:Syncrip UTSW 9 88456259 intron probably benign
R1500:Syncrip UTSW 9 88479896 missense probably damaging 0.98
R1952:Syncrip UTSW 9 88476874 missense probably damaging 1.00
R2437:Syncrip UTSW 9 88479567 splice site probably benign
R3779:Syncrip UTSW 9 88476939 missense probably damaging 1.00
R4770:Syncrip UTSW 9 88479852 missense probably damaging 1.00
R5677:Syncrip UTSW 9 88456709 unclassified probably benign
R6860:Syncrip UTSW 9 88476796 missense probably damaging 0.98
R7286:Syncrip UTSW 9 88464663 missense probably damaging 1.00
R7736:Syncrip UTSW 9 88461668 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCACACTTCAGGACTATTTAACAG -3'
(R):5'- TCTTCTCCAGGGCTAGTTGC -3'

Sequencing Primer
(F):5'- ACGGACTTAAAGCCACAG -3'
(R):5'- CTTTAAAAGAGTTCAATGAAGACGGC -3'
Posted On2015-01-23