Incidental Mutation 'R3715:Epm2a'
ID259859
Institutional Source Beutler Lab
Gene Symbol Epm2a
Ensembl Gene ENSMUSG00000055493
Gene Nameepilepsy, progressive myoclonic epilepsy, type 2 gene alpha
SynonymsTG-B, laforin, Tg(TcraK,TcrbK)TG-BFlv
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R3715 (G1)
Quality Score162
Status Validated
Chromosome10
Chromosomal Location11343404-11459644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11343676 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 69 (Y69C)
Ref Sequence ENSEMBL: ENSMUSP00000066050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069106]
Predicted Effect probably benign
Transcript: ENSMUST00000069106
AA Change: Y69C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066050
Gene: ENSMUSG00000055493
AA Change: Y69C

DomainStartEndE-ValueType
CBM_2 4 115 4.89e-14 SMART
Pfam:DSPc 163 314 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161438
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual-specificity phosphatase that associates with polyribosomes. The encoded protein may be involved in the regulation of glycogen metabolism. Mutations in this gene have been associated with myoclonic epilepsy of Lafora. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit behavioral deficits, ataxia, myoclonus epilepsy, and widespread degeneration of neurons in the presence of only a few small Lafora inclusions, providing a putative mouse model of human Lafora disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Epm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Epm2a APN 10 11448640 critical splice acceptor site probably null
IGL01925:Epm2a APN 10 11448758 missense possibly damaging 0.93
IGL02612:Epm2a APN 10 11457236 missense probably damaging 1.00
IGL03052:Epm2a UTSW 10 11457230 missense possibly damaging 0.95
R1432:Epm2a UTSW 10 11390843 missense probably damaging 0.99
R1716:Epm2a UTSW 10 11448836 missense probably benign 0.31
R1785:Epm2a UTSW 10 11343682 missense probably benign
R2132:Epm2a UTSW 10 11343682 missense probably benign
R2133:Epm2a UTSW 10 11343682 missense probably benign
R4794:Epm2a UTSW 10 11390853 missense probably benign 0.01
R5222:Epm2a UTSW 10 11448749 missense probably damaging 0.99
R5254:Epm2a UTSW 10 11457345 missense probably benign 0.00
R6608:Epm2a UTSW 10 11390987 critical splice donor site probably null
R6941:Epm2a UTSW 10 11391085 splice site probably null
R7211:Epm2a UTSW 10 11343675 missense probably benign 0.00
R7440:Epm2a UTSW 10 11390875 nonsense probably null
R7740:Epm2a UTSW 10 11390940 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATCTCTGGGAAGACGACAGG -3'
(R):5'- TGGCCAACAGTTAAGTGCAC -3'

Sequencing Primer
(F):5'- AGTGTGGGTCTCAGCCTCTC -3'
(R):5'- TTAAGTGCACGGGGAGCTG -3'
Posted On2015-01-23