Incidental Mutation 'R3715:Zfr2'
ID 259861
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Name zinc finger RNA binding protein 2
Synonyms 2010013I23Rik, 9130206N08Rik
MMRRC Submission 040708-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R3715 (G1)
Quality Score 180
Status Validated
Chromosome 10
Chromosomal Location 81068989-81087957 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 81081913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 493 (V493G)
Ref Sequence ENSEMBL: ENSMUSP00000113913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798]
AlphaFold E9Q5M4
Predicted Effect probably benign
Transcript: ENSMUST00000117798
AA Change: V493G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: V493G

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Predicted Effect probably benign
Transcript: ENSMUST00000137999
SMART Domains Protein: ENSMUSP00000120853
Gene: ENSMUSG00000034949

DomainStartEndE-ValueType
Pfam:DZF 2 162 1.3e-32 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148029
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,424,081 (GRCm39) M137V probably benign Het
9930111J21Rik1 T C 11: 48,838,803 (GRCm39) T595A possibly damaging Het
Aaas T C 15: 102,248,771 (GRCm39) I236V probably benign Het
Abcd4 C T 12: 84,658,533 (GRCm39) M223I probably benign Het
Adamtsl1 T A 4: 86,135,213 (GRCm39) I246N probably benign Het
Ak9 A G 10: 41,233,508 (GRCm39) D582G probably damaging Het
Aqr A G 2: 113,949,150 (GRCm39) probably benign Het
Bmal2 A G 6: 146,724,187 (GRCm39) K360E probably damaging Het
Cacna2d3 T C 14: 29,068,880 (GRCm39) I282M probably damaging Het
Cers3 G T 7: 66,435,823 (GRCm39) A261S probably benign Het
Dexi A T 16: 10,360,553 (GRCm39) M1K probably null Het
Dlat A G 9: 50,549,354 (GRCm39) V510A probably damaging Het
Eaf1 T C 14: 31,224,402 (GRCm39) I173T possibly damaging Het
Elavl3 G T 9: 21,929,895 (GRCm39) D336E probably benign Het
Epm2a A G 10: 11,219,420 (GRCm39) Y69C probably benign Het
Fam168a A G 7: 100,473,432 (GRCm39) N107S probably damaging Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Fras1 T C 5: 96,793,829 (GRCm39) probably null Het
Fscn3 C T 6: 28,428,091 (GRCm39) T26I possibly damaging Het
Glt8d2 C A 10: 82,488,571 (GRCm39) A300S probably benign Het
Hcn4 G A 9: 58,751,319 (GRCm39) R315H unknown Het
Lipk A G 19: 34,017,829 (GRCm39) N289S probably damaging Het
Lyg1 G T 1: 37,989,759 (GRCm39) R43S probably damaging Het
Marchf6 A G 15: 31,465,405 (GRCm39) L833P probably benign Het
Mc4r T A 18: 66,992,892 (GRCm39) N74Y probably damaging Het
Med17 G A 9: 15,175,062 (GRCm39) probably benign Het
Mink1 G T 11: 70,499,776 (GRCm39) R773L possibly damaging Het
Myo15a A T 11: 60,370,057 (GRCm39) E939V possibly damaging Het
Ndst4 A T 3: 125,355,154 (GRCm39) H354L possibly damaging Het
Or2t26 T C 11: 49,039,642 (GRCm39) L186P probably damaging Het
Or4c15 A G 2: 88,759,757 (GRCm39) W301R probably benign Het
Or4p22 C A 2: 88,317,787 (GRCm39) T237N probably damaging Het
Otof T A 5: 30,534,215 (GRCm39) K1397* probably null Het
Rangap1 C A 15: 81,594,661 (GRCm39) E389D probably benign Het
Rbfox2 A G 15: 76,983,451 (GRCm39) I270T probably damaging Het
Rnf217 G T 10: 31,410,728 (GRCm39) C322* probably null Het
Sbk1 A G 7: 125,889,183 (GRCm39) T50A probably benign Het
Shmt1 T C 11: 60,688,402 (GRCm39) T248A probably damaging Het
Smim29 G A 17: 27,785,043 (GRCm39) probably benign Het
Sox30 C T 11: 45,875,619 (GRCm39) T457I probably damaging Het
Stox2 T A 8: 47,866,187 (GRCm39) I52F possibly damaging Het
Syncrip A T 9: 88,361,738 (GRCm39) probably benign Het
Tars3 G A 7: 65,338,700 (GRCm39) probably null Het
Tdrd12 T C 7: 35,204,405 (GRCm39) E235G probably benign Het
Tmem82 A T 4: 141,344,945 (GRCm39) probably null Het
Tro T C X: 149,437,230 (GRCm39) T476A probably damaging Het
Ttn G A 2: 76,561,363 (GRCm39) P27302S probably damaging Het
Ttn C T 2: 76,571,610 (GRCm39) V26428I probably damaging Het
Usp53 T C 3: 122,742,968 (GRCm39) E656G probably benign Het
Vmn2r100 A G 17: 19,752,272 (GRCm39) R772G probably damaging Het
Xkr5 T C 8: 18,984,474 (GRCm39) E190G probably benign Het
Zfp236 A G 18: 82,651,095 (GRCm39) probably benign Het
Zp2 A T 7: 119,741,057 (GRCm39) S156T possibly damaging Het
Zswim5 A G 4: 116,819,755 (GRCm39) T387A probably benign Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81,077,919 (GRCm39) missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81,087,193 (GRCm39) missense probably benign
IGL01623:Zfr2 APN 10 81,087,193 (GRCm39) missense probably benign
IGL02719:Zfr2 APN 10 81,080,546 (GRCm39) missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81,077,985 (GRCm39) missense probably benign 0.01
R0302:Zfr2 UTSW 10 81,087,170 (GRCm39) unclassified probably benign
R0837:Zfr2 UTSW 10 81,081,242 (GRCm39) missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81,083,225 (GRCm39) missense probably benign 0.01
R1714:Zfr2 UTSW 10 81,080,583 (GRCm39) missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81,077,919 (GRCm39) missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81,078,686 (GRCm39) missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81,078,735 (GRCm39) missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81,077,950 (GRCm39) missense probably benign 0.13
R2150:Zfr2 UTSW 10 81,077,950 (GRCm39) missense probably benign 0.13
R3703:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3704:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3705:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R4301:Zfr2 UTSW 10 81,078,018 (GRCm39) unclassified probably benign
R4654:Zfr2 UTSW 10 81,087,083 (GRCm39) splice site probably null
R4811:Zfr2 UTSW 10 81,079,547 (GRCm39) missense probably benign 0.07
R5290:Zfr2 UTSW 10 81,082,544 (GRCm39) frame shift probably null
R5781:Zfr2 UTSW 10 81,079,547 (GRCm39) missense probably benign 0.07
R7114:Zfr2 UTSW 10 81,080,559 (GRCm39) missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81,078,649 (GRCm39) missense possibly damaging 0.83
R8359:Zfr2 UTSW 10 81,078,653 (GRCm39) missense possibly damaging 0.57
R8389:Zfr2 UTSW 10 81,081,323 (GRCm39) missense probably benign
R8827:Zfr2 UTSW 10 81,078,619 (GRCm39) missense probably benign 0.00
R8953:Zfr2 UTSW 10 81,084,271 (GRCm39) missense probably damaging 0.99
R9086:Zfr2 UTSW 10 81,076,029 (GRCm39) missense probably damaging 0.96
R9189:Zfr2 UTSW 10 81,080,496 (GRCm39) missense probably damaging 1.00
R9487:Zfr2 UTSW 10 81,075,969 (GRCm39) missense probably benign 0.33
R9592:Zfr2 UTSW 10 81,069,580 (GRCm39) missense unknown
R9645:Zfr2 UTSW 10 81,084,252 (GRCm39) nonsense probably null
X0063:Zfr2 UTSW 10 81,078,791 (GRCm39) critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81,081,918 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCTGATGCCCCATGATC -3'
(R):5'- ACAGACATGCTATGCTGGACC -3'

Sequencing Primer
(F):5'- GATGCCCCATGATCCCTGAC -3'
(R):5'- ATGCTATGCTGGACCCACAG -3'
Posted On 2015-01-23