Incidental Mutation 'R3715:9930111J21Rik1'
ID259864
Institutional Source Beutler Lab
Gene Symbol 9930111J21Rik1
Ensembl Gene ENSMUSG00000069893
Gene NameRIKEN cDNA 9930111J21 gene 1
Synonyms9930111J21Rik
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3715 (G1)
Quality Score181
Status Not validated
Chromosome11
Chromosomal Location48946150-48979398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48947976 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 595 (T595A)
Ref Sequence ENSEMBL: ENSMUSP00000095102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000097494] [ENSMUST00000104958]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097494
AA Change: T595A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095102
Gene: ENSMUSG00000069893
AA Change: T595A

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 1.9e-153 PFAM
Pfam:MMR_HSR1 483 611 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104958
SMART Domains Protein: ENSMUSP00000100564
Gene: ENSMUSG00000078153

DomainStartEndE-ValueType
Pfam:PA28_alpha 11 71 1.2e-26 PFAM
Pfam:PA28_beta 93 237 5.3e-58 PFAM
Meta Mutation Damage Score 0.5383 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in 9930111J21Rik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:9930111J21Rik1 APN 11 48948212 missense possibly damaging 0.66
IGL02189:9930111J21Rik1 APN 11 48947421 missense probably benign 0.09
IGL02554:9930111J21Rik1 APN 11 48948003 missense probably damaging 1.00
IGL03172:9930111J21Rik1 APN 11 48948176 missense probably damaging 1.00
IGL03334:9930111J21Rik1 APN 11 48947475 missense probably benign 0.09
R0502:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R0503:9930111J21Rik1 UTSW 11 48947495 missense possibly damaging 0.69
R2023:9930111J21Rik1 UTSW 11 48948420 missense possibly damaging 0.51
R3704:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3705:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3714:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3961:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R3962:9930111J21Rik1 UTSW 11 48947976 missense possibly damaging 0.95
R4867:9930111J21Rik1 UTSW 11 48948548 critical splice acceptor site probably null
R5033:9930111J21Rik1 UTSW 11 48947706 missense probably damaging 1.00
R5159:9930111J21Rik1 UTSW 11 48948525 missense probably benign 0.06
R6567:9930111J21Rik1 UTSW 11 48948123 missense probably benign 0.26
R6774:9930111J21Rik1 UTSW 11 48947316 missense possibly damaging 0.94
R7730:9930111J21Rik1 UTSW 11 48947876 missense probably benign 0.19
R7863:9930111J21Rik1 UTSW 11 48947274 missense probably benign 0.18
R7946:9930111J21Rik1 UTSW 11 48947274 missense probably benign 0.18
X0067:9930111J21Rik1 UTSW 11 48948042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCATGAAGAGGTGGCGC -3'
(R):5'- TTGCCTGGCATTGGGTCTAC -3'

Sequencing Primer
(F):5'- CTCAGTAGGGTGGTCTCCAG -3'
(R):5'- GGTCTACTACCTTCCCACCAC -3'
Posted On2015-01-23