Incidental Mutation 'R3715:Shmt1'
ID259867
Institutional Source Beutler Lab
Gene Symbol Shmt1
Ensembl Gene ENSMUSG00000020534
Gene Nameserine hydroxymethyltransferase 1 (soluble)
Synonymsmshmt1, Shmt, mshmt2, mshmt
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60788104-60811718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60797576 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 248 (T248A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018744]
Predicted Effect probably damaging
Transcript: ENSMUST00000018744
AA Change: T249A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018744
Gene: ENSMUSG00000020534
AA Change: T249A

DomainStartEndE-ValueType
Pfam:SHMT 20 419 1.3e-211 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174093
Predicted Effect probably benign
Transcript: ENSMUST00000174174
SMART Domains Protein: ENSMUSP00000134703
Gene: ENSMUSG00000020534

DomainStartEndE-ValueType
Pfam:SHMT 20 79 7.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174214
AA Change: T248A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134269
Gene: ENSMUSG00000020534
AA Change: T248A

DomainStartEndE-ValueType
Pfam:SHMT 20 408 4.6e-196 PFAM
Pfam:Aminotran_1_2 153 409 3.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174719
AA Change: T248A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134318
Gene: ENSMUSG00000020534
AA Change: T248A

DomainStartEndE-ValueType
Pfam:SHMT 20 268 6.4e-137 PFAM
Pfam:SHMT 265 380 3.9e-51 PFAM
Meta Mutation Damage Score 0.9014 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of serine hydroxymethyltransferase, a pyridoxal phosphate-containing enzyme that catalyzes the reversible conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. This reaction provides one-carbon units for synthesis of methionine, thymidylate, and purines in the cytoplasm. This gene is located within the Smith-Magenis syndrome region on chromosome 17. A pseudogene of this gene is located on the short arm of chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice with deficiencies in this gene display abnormalities in hepatic partioning of methylenetetrahydrofolate but are otherwise healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Shmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Shmt1 APN 11 60789653 missense probably damaging 1.00
PIT4514001:Shmt1 UTSW 11 60804347 missense probably damaging 1.00
R0470:Shmt1 UTSW 11 60792963 missense possibly damaging 0.91
R0787:Shmt1 UTSW 11 60792976 missense probably benign 0.00
R1768:Shmt1 UTSW 11 60792964 missense probably damaging 1.00
R2179:Shmt1 UTSW 11 60806999 missense possibly damaging 0.69
R4647:Shmt1 UTSW 11 60801465 missense probably damaging 1.00
R5024:Shmt1 UTSW 11 60797479 intron probably benign
R5183:Shmt1 UTSW 11 60797482 intron probably benign
R5461:Shmt1 UTSW 11 60794899 missense possibly damaging 0.94
R6014:Shmt1 UTSW 11 60797557 missense probably damaging 1.00
R6618:Shmt1 UTSW 11 60792946 splice site probably null
R6969:Shmt1 UTSW 11 60804327 missense probably damaging 1.00
R7108:Shmt1 UTSW 11 60798644 missense probably damaging 0.98
R7158:Shmt1 UTSW 11 60790242 missense probably benign 0.03
R7215:Shmt1 UTSW 11 60801535 missense probably damaging 0.99
R7514:Shmt1 UTSW 11 60801986 missense probably damaging 1.00
R8717:Shmt1 UTSW 11 60794937 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTTATTTCTTCCTGAGGAGC -3'
(R):5'- CTGTACTCTCAGAGGCCAACTC -3'

Sequencing Primer
(F):5'- AGCTCTTCCAAGGCCAGAG -3'
(R):5'- CTGGGGATCTTTGACACTACCATG -3'
Posted On2015-01-23