Incidental Mutation 'R3715:Abcd4'
ID259870
Institutional Source Beutler Lab
Gene Symbol Abcd4
Ensembl Gene ENSMUSG00000021240
Gene NameATP-binding cassette, sub-family D (ALD), member 4
SynonymsPxmp1l, P69r
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84601464-84617413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84611759 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 223 (M223I)
Ref Sequence ENSEMBL: ENSMUSP00000152694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021666] [ENSMUST00000221070] [ENSMUST00000222581] [ENSMUST00000223107]
Predicted Effect probably benign
Transcript: ENSMUST00000021666
AA Change: M227I

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021666
Gene: ENSMUSG00000021240
AA Change: M227I

DomainStartEndE-ValueType
Pfam:ABC_membrane_2 14 294 5.4e-86 PFAM
AAA 413 604 2.05e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220952
Predicted Effect probably benign
Transcript: ENSMUST00000221070
Predicted Effect probably benign
Transcript: ENSMUST00000222581
Predicted Effect probably benign
Transcript: ENSMUST00000222889
Predicted Effect probably benign
Transcript: ENSMUST00000223107
AA Change: M223I

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.5424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown. However, it is speculated that the human protein may function as a heterodimer for another peroxisomal ABC transporter and, therefore, may modify the adrenoleukodystrophy phenotype. It may also play a role in the process of peroxisome biogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Aaas T C 15: 102,340,336 I236V probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Abcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02075:Abcd4 APN 12 84608804 critical splice donor site probably null
IGL02103:Abcd4 APN 12 84612364 missense probably benign 0.00
IGL02892:Abcd4 APN 12 84604997 nonsense probably null
R0112:Abcd4 UTSW 12 84612899 splice site probably benign
R0128:Abcd4 UTSW 12 84612352 missense possibly damaging 0.89
R0144:Abcd4 UTSW 12 84605965 critical splice acceptor site probably null
R0866:Abcd4 UTSW 12 84611733 missense probably damaging 1.00
R0942:Abcd4 UTSW 12 84612828 missense probably damaging 0.96
R1770:Abcd4 UTSW 12 84615100 missense probably benign 0.08
R1796:Abcd4 UTSW 12 84615382 missense probably benign 0.09
R2113:Abcd4 UTSW 12 84609016 nonsense probably null
R3713:Abcd4 UTSW 12 84611759 missense probably benign 0.43
R3714:Abcd4 UTSW 12 84611759 missense probably benign 0.43
R5308:Abcd4 UTSW 12 84603293 critical splice donor site probably null
R5572:Abcd4 UTSW 12 84606276 missense probably benign 0.04
R5632:Abcd4 UTSW 12 84617302 missense probably benign 0.00
R5695:Abcd4 UTSW 12 84613971 missense probably damaging 1.00
R6111:Abcd4 UTSW 12 84615114 missense probably damaging 1.00
R6538:Abcd4 UTSW 12 84611761 missense probably benign 0.12
R7035:Abcd4 UTSW 12 84615349 missense probably damaging 1.00
R7139:Abcd4 UTSW 12 84606298 missense probably benign
R7368:Abcd4 UTSW 12 84612865 missense possibly damaging 0.56
R7374:Abcd4 UTSW 12 84606243 nonsense probably null
R7601:Abcd4 UTSW 12 84613945 missense possibly damaging 0.93
R7663:Abcd4 UTSW 12 84606129 missense probably damaging 1.00
R7990:Abcd4 UTSW 12 84604388 splice site probably null
R8286:Abcd4 UTSW 12 84603146 missense probably benign 0.04
R8312:Abcd4 UTSW 12 84615416 missense probably damaging 1.00
R8331:Abcd4 UTSW 12 84603952 missense probably damaging 1.00
R8469:Abcd4 UTSW 12 84612416 missense probably damaging 1.00
R8486:Abcd4 UTSW 12 84603978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTCCCCATACCTAAGG -3'
(R):5'- AGGTCCCATAGTCAAGCCTAC -3'

Sequencing Primer
(F):5'- GTCCCCATACCTAAGGACAGGG -3'
(R):5'- CTGAGGTCAGCACTGTTAGTACAG -3'
Posted On2015-01-23