Incidental Mutation 'R3715:Aaas'
ID259875
Institutional Source Beutler Lab
Gene Symbol Aaas
Ensembl Gene ENSMUSG00000036678
Gene Nameachalasia, adrenocortical insufficiency, alacrimia
SynonymsD030041N15Rik, GL003, Aladin
MMRRC Submission 040708-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R3715 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102338252-102350771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102340336 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 236 (I236V)
Ref Sequence ENSEMBL: ENSMUSP00000155757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000041208] [ENSMUST00000113682] [ENSMUST00000228959] [ENSMUST00000231061] [ENSMUST00000229900] [ENSMUST00000230481]
Predicted Effect probably benign
Transcript: ENSMUST00000001331
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041208
AA Change: I269V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678
AA Change: I269V

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113682
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170713
Predicted Effect probably benign
Transcript: ENSMUST00000171244
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171733
Predicted Effect probably benign
Transcript: ENSMUST00000228959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229315
Predicted Effect probably benign
Transcript: ENSMUST00000231061
AA Change: I236V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229589
Predicted Effect probably benign
Transcript: ENSMUST00000229900
Predicted Effect probably benign
Transcript: ENSMUST00000230481
Predicted Effect probably benign
Transcript: ENSMUST00000230406
Predicted Effect probably benign
Transcript: ENSMUST00000230239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230710
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice display female infertility, mildly decreased exploratory behavior, and decreased body weight, but have normal adrenocortical function and do not develop severe neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adamtsl1 T A 4: 86,216,976 I246N probably benign Het
AI413582 G A 17: 27,566,069 probably benign Het
Ak9 A G 10: 41,357,512 D582G probably damaging Het
Aqr A G 2: 114,118,669 probably benign Het
Arntl2 A G 6: 146,822,689 K360E probably damaging Het
Cacna2d3 T C 14: 29,346,923 I282M probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dlat A G 9: 50,638,054 V510A probably damaging Het
Eaf1 T C 14: 31,502,445 I173T possibly damaging Het
Elavl3 G T 9: 22,018,599 D336E probably benign Het
Epm2a A G 10: 11,343,676 Y69C probably benign Het
Fam168a A G 7: 100,824,225 N107S probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fras1 T C 5: 96,645,970 probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Glt8d2 C A 10: 82,652,737 A300S probably benign Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Lipk A G 19: 34,040,429 N289S probably damaging Het
Lyg1 G T 1: 37,950,678 R43S probably damaging Het
March6 A G 15: 31,465,259 L833P probably benign Het
Mc4r T A 18: 66,859,821 N74Y probably damaging Het
Med17 G A 9: 15,263,766 probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr1211 A G 2: 88,929,413 W301R probably benign Het
Olfr1395 T C 11: 49,148,815 L186P probably damaging Het
Otof T A 5: 30,376,871 K1397* probably null Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Rbfox2 A G 15: 77,099,251 I270T probably damaging Het
Rnf217 G T 10: 31,534,732 C322* probably null Het
Sbk1 A G 7: 126,290,011 T50A probably benign Het
Shmt1 T C 11: 60,797,576 T248A probably damaging Het
Sox30 C T 11: 45,984,792 T457I probably damaging Het
Stox2 T A 8: 47,413,152 I52F possibly damaging Het
Syncrip A T 9: 88,479,685 probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tdrd12 T C 7: 35,504,980 E235G probably benign Het
Tmem82 A T 4: 141,617,634 probably null Het
Tro T C X: 150,654,234 T476A probably damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn2r100 A G 17: 19,532,010 R772G probably damaging Het
Xkr5 T C 8: 18,934,458 E190G probably benign Het
Zfp236 A G 18: 82,632,970 probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zp2 A T 7: 120,141,834 S156T possibly damaging Het
Zswim5 A G 4: 116,962,558 T387A probably benign Het
Other mutations in Aaas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Aaas APN 15 102339374 missense possibly damaging 0.77
IGL01620:Aaas APN 15 102339950 missense probably damaging 1.00
IGL02337:Aaas APN 15 102339227 missense probably benign 0.01
IGL02608:Aaas APN 15 102339192 missense probably benign 0.00
IGL03024:Aaas APN 15 102350491 splice site probably benign
IGL03217:Aaas APN 15 102349995 missense probably damaging 1.00
IGL03273:Aaas APN 15 102349995 missense probably damaging 1.00
Shrinker UTSW 15 102346676 critical splice donor site probably null
R1545:Aaas UTSW 15 102339206 missense probably damaging 1.00
R1546:Aaas UTSW 15 102346718 missense probably benign 0.00
R1957:Aaas UTSW 15 102338633 unclassified probably benign
R1996:Aaas UTSW 15 102340059 missense probably benign 0.10
R1997:Aaas UTSW 15 102340059 missense probably benign 0.10
R3079:Aaas UTSW 15 102340444 missense probably damaging 0.99
R5427:Aaas UTSW 15 102339950 missense possibly damaging 0.94
R5586:Aaas UTSW 15 102346676 critical splice donor site probably null
R5620:Aaas UTSW 15 102338391 missense probably benign 0.00
R5969:Aaas UTSW 15 102350564 missense probably damaging 1.00
R6763:Aaas UTSW 15 102340022 missense probably null
R8230:Aaas UTSW 15 102338469 missense probably benign 0.03
R8698:Aaas UTSW 15 102338815 critical splice donor site probably benign
R8755:Aaas UTSW 15 102347085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGCAACTCATGGTGGGC -3'
(R):5'- TGTTCTCACAGTCATCAGCC -3'

Sequencing Primer
(F):5'- GGGCTACCCATTTATGTACACAAATC -3'
(R):5'- CCCCTCCCCCAATGCATTTG -3'
Posted On2015-01-23