Incidental Mutation 'R3716:Ubac1'
ID259890
Institutional Source Beutler Lab
Gene Symbol Ubac1
Ensembl Gene ENSMUSG00000036352
Gene Nameubiquitin associated domain containing 1
SynonymsUbadc1, 1110033G07Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R3716 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25998543-26021747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26014941 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 95 (R95H)
Ref Sequence ENSEMBL: ENSMUSP00000040220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036509]
Predicted Effect probably damaging
Transcript: ENSMUST00000036509
AA Change: R95H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040220
Gene: ENSMUSG00000036352
AA Change: R95H

DomainStartEndE-ValueType
Blast:UBQ 14 94 2e-38 BLAST
low complexity region 108 123 N/A INTRINSIC
UBA 193 230 2e-5 SMART
low complexity region 245 269 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
UBA 294 331 5.92e-8 SMART
STI1 357 396 1.85e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134990
Predicted Effect probably benign
Transcript: ENSMUST00000136750
SMART Domains Protein: ENSMUSP00000123115
Gene: ENSMUSG00000036352

DomainStartEndE-ValueType
internal_repeat_1 10 37 4.39e-5 PROSPERO
UBA 128 165 2e-5 SMART
low complexity region 180 204 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
UBA 229 258 5.2e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000146363
AA Change: R14H
SMART Domains Protein: ENSMUSP00000117683
Gene: ENSMUSG00000036352
AA Change: R14H

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
UBA 133 170 5.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150608
Meta Mutation Damage Score 0.1738 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,536 L690H probably damaging Het
Acaa1b A G 9: 119,156,641 V72A probably benign Het
Actl7a T C 4: 56,744,295 L274P possibly damaging Het
Ankrd50 T C 3: 38,454,150 E433G probably damaging Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
BC055324 T C 1: 163,956,888 I779M probably damaging Het
Btbd11 C T 10: 85,561,528 H442Y probably damaging Het
Canx A G 11: 50,304,474 S256P probably benign Het
Caps2 A G 10: 112,200,732 H399R probably benign Het
Col6a6 A C 9: 105,782,174 L524R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dglucy A T 12: 100,850,116 N339I probably damaging Het
Dhrs4 G T 14: 55,478,905 M1I probably null Het
Disp1 A T 1: 183,087,751 L1035Q probably damaging Het
Ephb1 T C 9: 102,194,800 E260G probably damaging Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Frem2 T C 3: 53,572,360 S1971G probably damaging Het
Gria2 A G 3: 80,741,004 Y142H possibly damaging Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il21r A G 7: 125,632,269 K290E probably damaging Het
Inpp5f C G 7: 128,690,670 L17V probably damaging Het
Kcnh3 A G 15: 99,232,765 N421S possibly damaging Het
Krt33a A C 11: 100,014,165 C172G probably benign Het
Lrp6 A T 6: 134,507,447 H404Q probably damaging Het
Macf1 T C 4: 123,473,502 T924A probably benign Het
Mepe C A 5: 104,337,428 H145N probably benign Het
Mesp2 T G 7: 79,812,794 L366R possibly damaging Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Mms19 A G 19: 41,944,735 V997A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Myo15b G T 11: 115,863,413 C913F probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nelfcd T C 2: 174,423,005 V179A possibly damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1104 A T 2: 87,022,363 Y60* probably null Het
Orc1 C T 4: 108,614,459 A836V probably damaging Het
Pcdhb6 G T 18: 37,336,206 V43L probably benign Het
Prkcd G T 14: 30,599,712 D393E probably benign Het
Rb1cc1 G C 1: 6,270,690 probably null Het
Rp1 T A 1: 4,349,765 T375S probably benign Het
Slc9c1 A T 16: 45,580,219 M731L probably benign Het
Sox21 A T 14: 118,235,430 M69K probably benign Het
Spata18 A T 5: 73,666,850 probably null Het
Taok1 A G 11: 77,541,810 F726L probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Usp32 A G 11: 85,042,563 Y40H probably damaging Het
Usp37 A T 1: 74,492,986 S83T possibly damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Ubac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Ubac1 APN 2 26006568 missense probably damaging 1.00
PIT4403001:Ubac1 UTSW 2 26006597 missense probably benign 0.16
R0029:Ubac1 UTSW 2 26021443 missense probably benign 0.15
R0121:Ubac1 UTSW 2 26008859 critical splice donor site probably null
R0178:Ubac1 UTSW 2 26021428 missense possibly damaging 0.87
R1839:Ubac1 UTSW 2 26007738 missense possibly damaging 0.70
R1891:Ubac1 UTSW 2 26014962 missense probably benign 0.10
R3717:Ubac1 UTSW 2 26014941 missense probably damaging 1.00
R3718:Ubac1 UTSW 2 26014941 missense probably damaging 1.00
R4602:Ubac1 UTSW 2 25998977 missense probably damaging 1.00
R6742:Ubac1 UTSW 2 26005406 missense possibly damaging 0.89
R7134:Ubac1 UTSW 2 26014962 missense probably benign 0.10
R8056:Ubac1 UTSW 2 26007897 missense probably benign 0.06
RF022:Ubac1 UTSW 2 26005458 missense probably damaging 1.00
Z1177:Ubac1 UTSW 2 26021553 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GATGAAGGGCCCCTTATACC -3'
(R):5'- GGAAGTCTGGGGTTGACATC -3'

Sequencing Primer
(F):5'- GGCCCCTTATACCACACATCCTG -3'
(R):5'- GAGGCAGAGTCTCTTGTTAAACCC -3'
Posted On2015-01-23