Incidental Mutation 'R3716:Actl7a'
ID 259901
Institutional Source Beutler Lab
Gene Symbol Actl7a
Ensembl Gene ENSMUSG00000070979
Gene Name actin-like 7a
Synonyms Tact2, t-actin 2
Accession Numbers
Essential gene? Possibly essential (E-score: 0.552) question?
Stock # R3716 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 56743422-56744925 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56744295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 274 (L274P)
Ref Sequence ENSEMBL: ENSMUSP00000092692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
AlphaFold Q9QY84
Predicted Effect possibly damaging
Transcript: ENSMUST00000095079
AA Change: L274P

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979
AA Change: L274P

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095080
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7A), and related gene, ACTL7B, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7A gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. The ACTL7A gene is expressed in a wide variety of adult tissues, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,363 (GRCm39) L690H probably damaging Het
Abtb3 C T 10: 85,397,392 (GRCm39) H442Y probably damaging Het
Acaa1b A G 9: 118,985,709 (GRCm39) V72A probably benign Het
Ankrd50 T C 3: 38,508,299 (GRCm39) E433G probably damaging Het
Ano6 A G 15: 95,811,260 (GRCm39) D120G probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Canx A G 11: 50,195,301 (GRCm39) S256P probably benign Het
Caps2 A G 10: 112,036,637 (GRCm39) H399R probably benign Het
Col6a6 A C 9: 105,659,373 (GRCm39) L524R probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dglucy A T 12: 100,816,375 (GRCm39) N339I probably damaging Het
Dhrs4 G T 14: 55,716,362 (GRCm39) M1I probably null Het
Disp1 A T 1: 182,869,315 (GRCm39) L1035Q probably damaging Het
Ephb1 T C 9: 102,071,999 (GRCm39) E260G probably damaging Het
Fetub T A 16: 22,754,443 (GRCm39) C217S probably damaging Het
Firrm T C 1: 163,784,457 (GRCm39) I779M probably damaging Het
Frem2 T C 3: 53,479,781 (GRCm39) S1971G probably damaging Het
Gria2 A G 3: 80,648,311 (GRCm39) Y142H possibly damaging Het
Hivep1 C T 13: 42,311,971 (GRCm39) H1404Y probably damaging Het
Il21r A G 7: 125,231,441 (GRCm39) K290E probably damaging Het
Inpp5f C G 7: 128,292,394 (GRCm39) L17V probably damaging Het
Kcnh3 A G 15: 99,130,646 (GRCm39) N421S possibly damaging Het
Krt33a A C 11: 99,904,991 (GRCm39) C172G probably benign Het
Lrp6 A T 6: 134,484,410 (GRCm39) H404Q probably damaging Het
Macf1 T C 4: 123,367,295 (GRCm39) T924A probably benign Het
Mepe C A 5: 104,485,294 (GRCm39) H145N probably benign Het
Mesp2 T G 7: 79,462,542 (GRCm39) L366R possibly damaging Het
Mink1 T A 11: 70,498,587 (GRCm39) L584Q probably damaging Het
Mms19 A G 19: 41,933,174 (GRCm39) V997A probably damaging Het
Mroh7 T C 4: 106,561,407 (GRCm39) E612G probably benign Het
Myo15b G T 11: 115,754,239 (GRCm39) C913F probably benign Het
Nav1 A T 1: 135,378,368 (GRCm39) I1653K probably damaging Het
Neb T C 2: 52,167,482 (GRCm39) E1948G probably damaging Het
Nelfcd T C 2: 174,264,798 (GRCm39) V179A possibly damaging Het
Obscn C T 11: 58,973,487 (GRCm39) C2157Y probably damaging Het
Or8i2 A T 2: 86,852,707 (GRCm39) Y60* probably null Het
Orc1 C T 4: 108,471,656 (GRCm39) A836V probably damaging Het
Pcdhb6 G T 18: 37,469,259 (GRCm39) V43L probably benign Het
Prkcd G T 14: 30,321,669 (GRCm39) D393E probably benign Het
Rb1cc1 G C 1: 6,340,914 (GRCm39) probably null Het
Rp1 T A 1: 4,419,988 (GRCm39) T375S probably benign Het
Slc9c1 A T 16: 45,400,582 (GRCm39) M731L probably benign Het
Sox21 A T 14: 118,472,842 (GRCm39) M69K probably benign Het
Spata18 A T 5: 73,824,193 (GRCm39) probably null Het
Taok1 A G 11: 77,432,636 (GRCm39) F726L probably benign Het
Ttn G A 2: 76,575,558 (GRCm39) P25112S probably damaging Het
Ubac1 C T 2: 25,904,953 (GRCm39) R95H probably damaging Het
Usp32 A G 11: 84,933,389 (GRCm39) Y40H probably damaging Het
Usp37 A T 1: 74,532,145 (GRCm39) S83T possibly damaging Het
Vps13d A G 4: 144,802,296 (GRCm39) I405T probably damaging Het
Other mutations in Actl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Actl7a APN 4 56,743,944 (GRCm39) missense possibly damaging 0.86
IGL01767:Actl7a APN 4 56,743,980 (GRCm39) missense probably damaging 1.00
IGL02626:Actl7a APN 4 56,744,353 (GRCm39) missense possibly damaging 0.89
R0046:Actl7a UTSW 4 56,743,877 (GRCm39) nonsense probably null
R0046:Actl7a UTSW 4 56,743,877 (GRCm39) nonsense probably null
R1741:Actl7a UTSW 4 56,744,252 (GRCm39) missense probably benign 0.03
R1920:Actl7a UTSW 4 56,744,135 (GRCm39) missense probably damaging 1.00
R2984:Actl7a UTSW 4 56,744,531 (GRCm39) missense probably benign 0.00
R4779:Actl7a UTSW 4 56,743,632 (GRCm39) missense probably benign 0.07
R5391:Actl7a UTSW 4 56,743,661 (GRCm39) missense probably benign
R5540:Actl7a UTSW 4 56,744,388 (GRCm39) missense probably benign 0.00
R5723:Actl7a UTSW 4 56,744,310 (GRCm39) missense probably damaging 0.99
R5902:Actl7a UTSW 4 56,743,827 (GRCm39) missense probably damaging 1.00
R5903:Actl7a UTSW 4 56,743,827 (GRCm39) missense probably damaging 1.00
R5922:Actl7a UTSW 4 56,743,827 (GRCm39) missense probably damaging 1.00
R6010:Actl7a UTSW 4 56,743,870 (GRCm39) missense possibly damaging 0.50
R6786:Actl7a UTSW 4 56,744,116 (GRCm39) nonsense probably null
R7168:Actl7a UTSW 4 56,743,769 (GRCm39) missense probably benign
R7568:Actl7a UTSW 4 56,744,498 (GRCm39) missense probably damaging 1.00
R8230:Actl7a UTSW 4 56,743,768 (GRCm39) missense probably damaging 1.00
R8305:Actl7a UTSW 4 56,743,744 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TTGAGACCTTCAACACACCTGC -3'
(R):5'- TGGCTTGAAGAACATCTCCG -3'

Sequencing Primer
(F):5'- GTCCATGTACTCCTACGGACG -3'
(R):5'- GCTTGAAGAACATCTCCGAGCAG -3'
Posted On 2015-01-23