Incidental Mutation 'R3716:Inpp5f'
ID 259914
Institutional Source Beutler Lab
Gene Symbol Inpp5f
Ensembl Gene ENSMUSG00000042105
Gene Name inositol polyphosphate-5-phosphatase F
Synonyms cI-27, 5830435P03Rik, SAC2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock # R3716 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 128611328-128696425 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 128690670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 17 (L17V)
Ref Sequence ENSEMBL: ENSMUSP00000113700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043138] [ENSMUST00000118605] [ENSMUST00000151237] [ENSMUST00000202419]
AlphaFold Q8CDA1
Predicted Effect probably damaging
Transcript: ENSMUST00000043138
AA Change: L644V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: L644V

DomainStartEndE-ValueType
Pfam:Syja_N 49 416 1.2e-85 PFAM
Blast:IPPc 449 568 6e-13 BLAST
Pfam:hSac2 590 698 9.1e-25 PFAM
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1059 1065 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118475
Predicted Effect probably damaging
Transcript: ENSMUST00000118605
AA Change: L17V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113700
Gene: ENSMUSG00000042105
AA Change: L17V

DomainStartEndE-ValueType
Pfam:hSac2 1 73 8.9e-21 PFAM
low complexity region 415 427 N/A INTRINSIC
low complexity region 432 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142075
Predicted Effect probably benign
Transcript: ENSMUST00000151237
Predicted Effect unknown
Transcript: ENSMUST00000202419
AA Change: C104W
SMART Domains Protein: ENSMUSP00000143952
Gene: ENSMUSG00000042105
AA Change: C104W

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:VMA21 30 84 9.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202892
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,536 L690H probably damaging Het
Acaa1b A G 9: 119,156,641 V72A probably benign Het
Actl7a T C 4: 56,744,295 L274P possibly damaging Het
Ankrd50 T C 3: 38,454,150 E433G probably damaging Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
BC055324 T C 1: 163,956,888 I779M probably damaging Het
Btbd11 C T 10: 85,561,528 H442Y probably damaging Het
Canx A G 11: 50,304,474 S256P probably benign Het
Caps2 A G 10: 112,200,732 H399R probably benign Het
Col6a6 A C 9: 105,782,174 L524R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dglucy A T 12: 100,850,116 N339I probably damaging Het
Dhrs4 G T 14: 55,478,905 M1I probably null Het
Disp1 A T 1: 183,087,751 L1035Q probably damaging Het
Ephb1 T C 9: 102,194,800 E260G probably damaging Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Frem2 T C 3: 53,572,360 S1971G probably damaging Het
Gria2 A G 3: 80,741,004 Y142H possibly damaging Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il21r A G 7: 125,632,269 K290E probably damaging Het
Kcnh3 A G 15: 99,232,765 N421S possibly damaging Het
Krt33a A C 11: 100,014,165 C172G probably benign Het
Lrp6 A T 6: 134,507,447 H404Q probably damaging Het
Macf1 T C 4: 123,473,502 T924A probably benign Het
Mepe C A 5: 104,337,428 H145N probably benign Het
Mesp2 T G 7: 79,812,794 L366R possibly damaging Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Mms19 A G 19: 41,944,735 V997A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Myo15b G T 11: 115,863,413 C913F probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nelfcd T C 2: 174,423,005 V179A possibly damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1104 A T 2: 87,022,363 Y60* probably null Het
Orc1 C T 4: 108,614,459 A836V probably damaging Het
Pcdhb6 G T 18: 37,336,206 V43L probably benign Het
Prkcd G T 14: 30,599,712 D393E probably benign Het
Rb1cc1 G C 1: 6,270,690 probably null Het
Rp1 T A 1: 4,349,765 T375S probably benign Het
Slc9c1 A T 16: 45,580,219 M731L probably benign Het
Sox21 A T 14: 118,235,430 M69K probably benign Het
Spata18 A T 5: 73,666,850 probably null Het
Taok1 A G 11: 77,541,810 F726L probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Usp32 A G 11: 85,042,563 Y40H probably damaging Het
Usp37 A T 1: 74,492,986 S83T possibly damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Inpp5f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Inpp5f APN 7 128664267 missense probably benign 0.04
IGL01316:Inpp5f APN 7 128690706 splice site probably benign
IGL01455:Inpp5f APN 7 128678049 missense probably damaging 1.00
IGL01471:Inpp5f APN 7 128675398 missense probably damaging 0.99
IGL01590:Inpp5f APN 7 128664307 critical splice donor site probably null
IGL01942:Inpp5f APN 7 128667769 missense probably damaging 1.00
IGL02092:Inpp5f APN 7 128685224 missense probably damaging 1.00
IGL02137:Inpp5f APN 7 128695129 missense probably damaging 1.00
IGL02664:Inpp5f APN 7 128664014 missense probably damaging 1.00
IGL02812:Inpp5f APN 7 128682306 missense probably damaging 1.00
IGL02942:Inpp5f APN 7 128694900 missense probably benign 0.29
PIT4480001:Inpp5f UTSW 7 128685134 missense probably benign 0.32
PIT4812001:Inpp5f UTSW 7 128692308 missense probably benign 0.39
R0243:Inpp5f UTSW 7 128695183 missense probably damaging 1.00
R0346:Inpp5f UTSW 7 128690668 missense probably damaging 1.00
R1186:Inpp5f UTSW 7 128694583 missense probably benign
R1375:Inpp5f UTSW 7 128664029 nonsense probably null
R1918:Inpp5f UTSW 7 128663969 splice site probably benign
R2307:Inpp5f UTSW 7 128694310 missense probably damaging 1.00
R4157:Inpp5f UTSW 7 128679699 intron probably benign
R4647:Inpp5f UTSW 7 128659109 missense possibly damaging 0.94
R4705:Inpp5f UTSW 7 128663987 missense probably damaging 0.97
R4713:Inpp5f UTSW 7 128663725 missense probably damaging 0.99
R4818:Inpp5f UTSW 7 128685129 missense probably damaging 1.00
R4914:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4915:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R4917:Inpp5f UTSW 7 128685116 missense probably damaging 1.00
R5069:Inpp5f UTSW 7 128676727 critical splice acceptor site probably null
R5181:Inpp5f UTSW 7 128679831 missense probably damaging 1.00
R5234:Inpp5f UTSW 7 128663683 missense probably benign
R6299:Inpp5f UTSW 7 128636160 missense possibly damaging 0.87
R6389:Inpp5f UTSW 7 128678056 missense probably damaging 1.00
R6530:Inpp5f UTSW 7 128664078 nonsense probably null
R6545:Inpp5f UTSW 7 128694556 missense possibly damaging 0.88
R7259:Inpp5f UTSW 7 128669957 missense probably benign 0.00
R7383:Inpp5f UTSW 7 128694586 missense probably damaging 1.00
R7427:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7428:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R7679:Inpp5f UTSW 7 128694523 missense possibly damaging 0.68
R7809:Inpp5f UTSW 7 128667643 missense probably damaging 1.00
R7840:Inpp5f UTSW 7 128694802 missense probably benign
R7912:Inpp5f UTSW 7 128692313 missense probably benign
R7915:Inpp5f UTSW 7 128667709 missense probably benign 0.25
R7960:Inpp5f UTSW 7 128693914 splice site probably null
R8027:Inpp5f UTSW 7 128690673 missense probably damaging 1.00
R8154:Inpp5f UTSW 7 128664267 missense possibly damaging 0.73
R8213:Inpp5f UTSW 7 128679805 missense probably damaging 1.00
R9499:Inpp5f UTSW 7 128693713 missense possibly damaging 0.62
R9519:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9544:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9597:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9598:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9634:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9701:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9702:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9784:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9802:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
R9803:Inpp5f UTSW 7 128676791 missense possibly damaging 0.62
RF001:Inpp5f UTSW 7 128695083 missense probably damaging 1.00
X0061:Inpp5f UTSW 7 128682297 missense probably damaging 1.00
Z1088:Inpp5f UTSW 7 128694949 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCCCAAAATGGATGTAGATTGCTTC -3'
(R):5'- GATTAAACAGAGTGCGTGATGC -3'

Sequencing Primer
(F):5'- CCTGGGCAATCTTTTCTTG -3'
(R):5'- GCCCAGATTGTGATGAATTCC -3'
Posted On 2015-01-23