Incidental Mutation 'R3716:Slc9c1'
ID259939
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R3716 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45580219 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 731 (M731L)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: M731L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: M731L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,536 L690H probably damaging Het
Acaa1b A G 9: 119,156,641 V72A probably benign Het
Actl7a T C 4: 56,744,295 L274P possibly damaging Het
Ankrd50 T C 3: 38,454,150 E433G probably damaging Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
BC055324 T C 1: 163,956,888 I779M probably damaging Het
Btbd11 C T 10: 85,561,528 H442Y probably damaging Het
Canx A G 11: 50,304,474 S256P probably benign Het
Caps2 A G 10: 112,200,732 H399R probably benign Het
Col6a6 A C 9: 105,782,174 L524R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dglucy A T 12: 100,850,116 N339I probably damaging Het
Dhrs4 G T 14: 55,478,905 M1I probably null Het
Disp1 A T 1: 183,087,751 L1035Q probably damaging Het
Ephb1 T C 9: 102,194,800 E260G probably damaging Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Frem2 T C 3: 53,572,360 S1971G probably damaging Het
Gria2 A G 3: 80,741,004 Y142H possibly damaging Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il21r A G 7: 125,632,269 K290E probably damaging Het
Inpp5f C G 7: 128,690,670 L17V probably damaging Het
Kcnh3 A G 15: 99,232,765 N421S possibly damaging Het
Krt33a A C 11: 100,014,165 C172G probably benign Het
Lrp6 A T 6: 134,507,447 H404Q probably damaging Het
Macf1 T C 4: 123,473,502 T924A probably benign Het
Mepe C A 5: 104,337,428 H145N probably benign Het
Mesp2 T G 7: 79,812,794 L366R possibly damaging Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Mms19 A G 19: 41,944,735 V997A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Myo15b G T 11: 115,863,413 C913F probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nelfcd T C 2: 174,423,005 V179A possibly damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1104 A T 2: 87,022,363 Y60* probably null Het
Orc1 C T 4: 108,614,459 A836V probably damaging Het
Pcdhb6 G T 18: 37,336,206 V43L probably benign Het
Prkcd G T 14: 30,599,712 D393E probably benign Het
Rb1cc1 G C 1: 6,270,690 probably null Het
Rp1 T A 1: 4,349,765 T375S probably benign Het
Sox21 A T 14: 118,235,430 M69K probably benign Het
Spata18 A T 5: 73,666,850 probably null Het
Taok1 A G 11: 77,541,810 F726L probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Usp32 A G 11: 85,042,563 Y40H probably damaging Het
Usp37 A T 1: 74,492,986 S83T possibly damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACTGGTAATGTTTGCATTCCC -3'
(R):5'- AGGTAGCTGAATGGCTTAAACATC -3'

Sequencing Primer
(F):5'- GCCACTGAGAGTTTGAGTACACTTAG -3'
(R):5'- GCTTAAACATCAGCCAGCCAG -3'
Posted On2015-01-23