Incidental Mutation 'R3716:Slc9c1'
ID 259939
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R3716 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45400582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 731 (M731L)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: M731L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: M731L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 48,910,363 (GRCm39) L690H probably damaging Het
Abtb3 C T 10: 85,397,392 (GRCm39) H442Y probably damaging Het
Acaa1b A G 9: 118,985,709 (GRCm39) V72A probably benign Het
Actl7a T C 4: 56,744,295 (GRCm39) L274P possibly damaging Het
Ankrd50 T C 3: 38,508,299 (GRCm39) E433G probably damaging Het
Ano6 A G 15: 95,811,260 (GRCm39) D120G probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Canx A G 11: 50,195,301 (GRCm39) S256P probably benign Het
Caps2 A G 10: 112,036,637 (GRCm39) H399R probably benign Het
Col6a6 A C 9: 105,659,373 (GRCm39) L524R probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dglucy A T 12: 100,816,375 (GRCm39) N339I probably damaging Het
Dhrs4 G T 14: 55,716,362 (GRCm39) M1I probably null Het
Disp1 A T 1: 182,869,315 (GRCm39) L1035Q probably damaging Het
Ephb1 T C 9: 102,071,999 (GRCm39) E260G probably damaging Het
Fetub T A 16: 22,754,443 (GRCm39) C217S probably damaging Het
Firrm T C 1: 163,784,457 (GRCm39) I779M probably damaging Het
Frem2 T C 3: 53,479,781 (GRCm39) S1971G probably damaging Het
Gria2 A G 3: 80,648,311 (GRCm39) Y142H possibly damaging Het
Hivep1 C T 13: 42,311,971 (GRCm39) H1404Y probably damaging Het
Il21r A G 7: 125,231,441 (GRCm39) K290E probably damaging Het
Inpp5f C G 7: 128,292,394 (GRCm39) L17V probably damaging Het
Kcnh3 A G 15: 99,130,646 (GRCm39) N421S possibly damaging Het
Krt33a A C 11: 99,904,991 (GRCm39) C172G probably benign Het
Lrp6 A T 6: 134,484,410 (GRCm39) H404Q probably damaging Het
Macf1 T C 4: 123,367,295 (GRCm39) T924A probably benign Het
Mepe C A 5: 104,485,294 (GRCm39) H145N probably benign Het
Mesp2 T G 7: 79,462,542 (GRCm39) L366R possibly damaging Het
Mink1 T A 11: 70,498,587 (GRCm39) L584Q probably damaging Het
Mms19 A G 19: 41,933,174 (GRCm39) V997A probably damaging Het
Mroh7 T C 4: 106,561,407 (GRCm39) E612G probably benign Het
Myo15b G T 11: 115,754,239 (GRCm39) C913F probably benign Het
Nav1 A T 1: 135,378,368 (GRCm39) I1653K probably damaging Het
Neb T C 2: 52,167,482 (GRCm39) E1948G probably damaging Het
Nelfcd T C 2: 174,264,798 (GRCm39) V179A possibly damaging Het
Obscn C T 11: 58,973,487 (GRCm39) C2157Y probably damaging Het
Or8i2 A T 2: 86,852,707 (GRCm39) Y60* probably null Het
Orc1 C T 4: 108,471,656 (GRCm39) A836V probably damaging Het
Pcdhb6 G T 18: 37,469,259 (GRCm39) V43L probably benign Het
Prkcd G T 14: 30,321,669 (GRCm39) D393E probably benign Het
Rb1cc1 G C 1: 6,340,914 (GRCm39) probably null Het
Rp1 T A 1: 4,419,988 (GRCm39) T375S probably benign Het
Sox21 A T 14: 118,472,842 (GRCm39) M69K probably benign Het
Spata18 A T 5: 73,824,193 (GRCm39) probably null Het
Taok1 A G 11: 77,432,636 (GRCm39) F726L probably benign Het
Ttn G A 2: 76,575,558 (GRCm39) P25112S probably damaging Het
Ubac1 C T 2: 25,904,953 (GRCm39) R95H probably damaging Het
Usp32 A G 11: 84,933,389 (GRCm39) Y40H probably damaging Het
Usp37 A T 1: 74,532,145 (GRCm39) S83T possibly damaging Het
Vps13d A G 4: 144,802,296 (GRCm39) I405T probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACTGGTAATGTTTGCATTCCC -3'
(R):5'- AGGTAGCTGAATGGCTTAAACATC -3'

Sequencing Primer
(F):5'- GCCACTGAGAGTTTGAGTACACTTAG -3'
(R):5'- GCTTAAACATCAGCCAGCCAG -3'
Posted On 2015-01-23