Incidental Mutation 'R3717:Rbbp4'
ID259954
Institutional Source Beutler Lab
Gene Symbol Rbbp4
Ensembl Gene ENSMUSG00000057236
Gene Nameretinoblastoma binding protein 4, chromatin remodeling factor
SynonymsCAF-1 p48 subunit, RBAP48
MMRRC Submission 040709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3717 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129307100-129335370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129328632 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 89 (D89V)
Ref Sequence ENSEMBL: ENSMUSP00000099658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102598] [ENSMUST00000135585]
Predicted Effect probably benign
Transcript: ENSMUST00000102598
AA Change: D89V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099658
Gene: ENSMUSG00000057236
AA Change: D89V

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 19 88 1.3e-28 PFAM
WD40 112 153 8.25e0 SMART
WD40 166 206 2.07e-6 SMART
WD40 216 256 4.48e-2 SMART
WD40 262 302 5.81e-10 SMART
WD40 306 346 3.93e-7 SMART
WD40 363 403 1.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147183
Meta Mutation Damage Score 0.1608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. It is present in protein complexes involved in histone acetylation and chromatin assembly. It is part of the Mi-2 complex which has been implicated in chromatin remodeling and transcriptional repression associated with histone deacetylation. This encoded protein is also part of co-repressor complexes, which is an integral component of transcriptional silencing. It is found among several cellular proteins that bind directly to retinoblastoma protein to regulate cell proliferation. This protein also seems to be involved in transcriptional repression of E2F-responsive genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 C T 16: 45,731,774 W245* probably null Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bpifb6 A G 2: 153,908,141 probably benign Het
Cmtr2 T C 8: 110,221,754 V232A probably damaging Het
Cmya5 A T 13: 93,092,487 M2031K probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Fgfr2 G A 7: 130,182,757 T270M probably damaging Het
Hoxd10 C T 2: 74,694,130 T262I probably damaging Het
Htt G A 5: 34,811,522 probably benign Het
Kbtbd3 A T 9: 4,330,598 H324L probably benign Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nxpe5 T C 5: 138,251,624 S559P probably damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr826 T A 10: 130,180,500 I127F possibly damaging Het
Ptx3 G T 3: 66,224,955 S299I probably benign Het
Rfx4 A G 10: 84,880,224 E375G probably damaging Het
Senp7 T A 16: 56,179,057 probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Skiv2l2 A G 13: 112,895,595 F561S probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spata18 A T 5: 73,666,850 probably null Het
St8sia6 T C 2: 13,656,934 N362S possibly damaging Het
Tmub2 G T 11: 102,285,061 probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ttn T C 2: 76,944,710 D1996G possibly damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vdac1 A G 11: 52,376,646 probably null Het
Vps51 G A 19: 6,077,168 probably benign Het
Zfp90 A G 8: 106,424,050 R132G probably benign Het
Other mutations in Rbbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rbbp4 APN 4 129310153 missense probably benign 0.06
IGL01150:Rbbp4 APN 4 129322875 splice site probably benign
IGL02228:Rbbp4 APN 4 129317750 missense probably damaging 1.00
R0864:Rbbp4 UTSW 4 129320551 splice site probably benign
R1056:Rbbp4 UTSW 4 129317649 missense probably damaging 0.99
R3762:Rbbp4 UTSW 4 129334551 missense probably damaging 1.00
R6148:Rbbp4 UTSW 4 129321958 missense probably benign
R6593:Rbbp4 UTSW 4 129322375 missense probably damaging 1.00
R6676:Rbbp4 UTSW 4 129328621 missense probably benign
R7741:Rbbp4 UTSW 4 129334563 missense probably damaging 0.99
R8045:Rbbp4 UTSW 4 129317900 missense probably benign 0.00
R9010:Rbbp4 UTSW 4 129322387 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGCATCTCATGTACCTGG -3'
(R):5'- CTTGAACTTAAGGAGGGGTCTG -3'

Sequencing Primer
(F):5'- CACTTCCAGGGGATCTGATATC -3'
(R):5'- ACTATCTCAAGATGGAATTGTTTGG -3'
Posted On2015-01-23