Incidental Mutation 'R0330:Fanca'
ID25996
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene NameFanconi anemia, complementation group A
Synonyms
MMRRC Submission 038539-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.699) question?
Stock #R0330 (G1)
Quality Score196
Status Not validated
Chromosome8
Chromosomal Location123268300-123318576 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 123274172 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1156 (C1156*)
Ref Sequence ENSEMBL: ENSMUSP00000045217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000035495] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000001092
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035495
AA Change: C1156*
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: C1156*

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126834
SMART Domains Protein: ENSMUSP00000116732
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155510
SMART Domains Protein: ENSMUSP00000118712
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 54 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211934
Predicted Effect probably benign
Transcript: ENSMUST00000213090
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
Acaa1b T C 9: 119,153,970 N120S probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
AI661453 G A 17: 47,446,646 R76Q probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap12 T A 18: 6,039,382 D455V probably damaging Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Arhgef12 A C 9: 43,020,686 H168Q probably damaging Het
Arhgef2 A G 3: 88,642,501 H592R probably damaging Het
BC049715 A G 6: 136,840,037 T92A possibly damaging Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Capn8 T A 1: 182,630,138 I689N probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cep57 G A 9: 13,816,985 R148W probably damaging Het
Cftr T A 6: 18,226,097 M318K probably null Het
Chd3 T G 11: 69,356,333 D1003A probably damaging Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cldn13 A G 5: 134,915,322 V3A probably benign Het
Col17a1 T C 19: 47,670,432 T413A probably benign Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Flot2 T A 11: 78,058,958 I322N possibly damaging Het
Fstl5 T C 3: 76,707,753 V707A possibly damaging Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Gtf2i T C 5: 134,251,886 E518G probably damaging Het
Hrasls5 T A 19: 7,637,298 probably null Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Impg2 A G 16: 56,252,264 Y353C probably damaging Het
Kank1 A G 19: 25,424,313 K1095E probably benign Het
Kcnh4 C T 11: 100,757,743 C45Y probably damaging Het
Kif13b A G 14: 64,803,220 T1590A probably benign Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrp1b A T 2: 40,701,761 C73* probably null Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Med12l A G 3: 59,227,702 E757G probably damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myof A C 19: 37,935,878 I1297S probably damaging Het
Nacad A G 11: 6,600,903 S763P probably benign Het
Nbea A G 3: 55,642,817 V2730A probably benign Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr370 A G 8: 83,541,513 Y123C probably damaging Het
Olfr828 A G 9: 18,815,641 Y218H probably damaging Het
Optn A T 2: 5,034,255 N352K possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Phxr2 T C 10: 99,126,117 probably benign Het
Plb1 T A 5: 32,355,357 F1353Y probably damaging Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pygo2 T A 3: 89,433,154 N286K possibly damaging Het
Rttn G A 18: 88,986,080 probably null Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Sidt2 A G 9: 45,954,902 I2T probably benign Het
Slc12a3 A T 8: 94,346,346 N699I possibly damaging Het
Slc25a30 G A 14: 75,762,672 Q285* probably null Het
Slc4a9 A T 18: 36,535,539 H724L probably damaging Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stac3 C A 10: 127,507,747 probably null Het
Stk32a A G 18: 43,313,501 K339E probably benign Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tbc1d16 A G 11: 119,158,729 probably null Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Trappc12 A G 12: 28,747,260 V91A probably benign Het
Trim46 G T 3: 89,236,513 P536Q probably damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Vps4a A C 8: 107,043,066 I336L probably benign Het
Xylb T C 9: 119,381,587 S379P probably damaging Het
Zbtb37 T C 1: 161,032,496 T80A probably benign Het
Zfhx3 A G 8: 108,948,957 D2213G probably damaging Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Zfp804b A T 5: 6,771,029 I642N possibly damaging Het
Zfp804b A T 5: 6,771,994 N356K possibly damaging Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 123305263 missense probably damaging 1.00
IGL02805:Fanca APN 8 123289494 missense probably damaging 0.99
IGL03280:Fanca APN 8 123316459 unclassified probably benign
PIT4402001:Fanca UTSW 8 123313064 missense possibly damaging 0.83
R0114:Fanca UTSW 8 123288491 splice site probably null
R0115:Fanca UTSW 8 123268539 missense probably benign 0.00
R0271:Fanca UTSW 8 123272441 unclassified probably benign
R0345:Fanca UTSW 8 123304813 missense probably damaging 1.00
R0570:Fanca UTSW 8 123306430 missense probably benign 0.01
R0601:Fanca UTSW 8 123308513 missense probably damaging 0.99
R0617:Fanca UTSW 8 123288070 missense probably damaging 0.99
R0639:Fanca UTSW 8 123289359 critical splice donor site probably null
R0943:Fanca UTSW 8 123274186 missense probably damaging 1.00
R1140:Fanca UTSW 8 123313129 splice site probably null
R1364:Fanca UTSW 8 123304281 splice site probably benign
R1366:Fanca UTSW 8 123304281 splice site probably benign
R1367:Fanca UTSW 8 123304281 splice site probably benign
R1368:Fanca UTSW 8 123304281 splice site probably benign
R1969:Fanca UTSW 8 123288064 missense probably benign 0.41
R1992:Fanca UTSW 8 123297812 missense possibly damaging 0.94
R2060:Fanca UTSW 8 123274481 missense probably damaging 1.00
R2174:Fanca UTSW 8 123271270 missense probably benign 0.00
R2261:Fanca UTSW 8 123289359 critical splice donor site probably null
R3957:Fanca UTSW 8 123316363 missense probably benign 0.00
R4062:Fanca UTSW 8 123275172 missense probably benign 0.00
R4153:Fanca UTSW 8 123304878 missense possibly damaging 0.89
R4270:Fanca UTSW 8 123268794 missense probably damaging 1.00
R4424:Fanca UTSW 8 123288793 missense probably benign 0.11
R4581:Fanca UTSW 8 123274338 unclassified probably null
R4639:Fanca UTSW 8 123318150 missense probably damaging 0.98
R4664:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4665:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4666:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4686:Fanca UTSW 8 123268934 splice site probably benign
R4775:Fanca UTSW 8 123296306 missense probably damaging 0.99
R4782:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4799:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4926:Fanca UTSW 8 123303985 missense probably benign 0.05
R4973:Fanca UTSW 8 123308522 missense probably damaging 0.96
R5039:Fanca UTSW 8 123284046 missense probably benign
R5195:Fanca UTSW 8 123303945 intron probably benign
R5590:Fanca UTSW 8 123303963 intron probably benign
R5848:Fanca UTSW 8 123295053 intron probably benign
R5965:Fanca UTSW 8 123316410 missense possibly damaging 0.46
R6224:Fanca UTSW 8 123305281 missense possibly damaging 0.87
R6385:Fanca UTSW 8 123305867 unclassified probably null
R6762:Fanca UTSW 8 123271303 missense probably benign 0.26
R6795:Fanca UTSW 8 123318493 missense probably benign 0.02
R6810:Fanca UTSW 8 123286477 missense probably damaging 0.99
R7153:Fanca UTSW 8 123316425 missense probably damaging 1.00
R7170:Fanca UTSW 8 123271206 missense probably damaging 1.00
R7204:Fanca UTSW 8 123286477 missense probably damaging 0.98
R7366:Fanca UTSW 8 123281213 missense probably benign 0.08
R7599:Fanca UTSW 8 123271260 missense probably benign
R7639:Fanca UTSW 8 123291395 critical splice donor site probably null
R7650:Fanca UTSW 8 123268564 splice site probably null
R8066:Fanca UTSW 8 123303940 missense unknown
V7732:Fanca UTSW 8 123304281 splice site probably benign
X0025:Fanca UTSW 8 123276548 intron probably benign
X0062:Fanca UTSW 8 123304852 missense possibly damaging 0.95
Z1177:Fanca UTSW 8 123312629 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATACTGACCACCAGGGTAGGAC -3'
(R):5'- CAGGGTAATGTGATGCCTCCTTCG -3'

Sequencing Primer
(F):5'- gaagtctcaatgggaaaaggtg -3'
(R):5'- GTGTGTGTCTCCGAAGTCAA -3'
Posted On2013-04-16