Incidental Mutation 'R3717:Kbtbd3'
ID259962
Institutional Source Beutler Lab
Gene Symbol Kbtbd3
Ensembl Gene ENSMUSG00000025893
Gene Namekelch repeat and BTB (POZ) domain containing 3
SynonymsBklhd3, 2200003A07Rik
MMRRC Submission 040709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R3717 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location4309833-4331732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4330598 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 324 (H324L)
Ref Sequence ENSEMBL: ENSMUSP00000148445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049648] [ENSMUST00000212221]
Predicted Effect probably benign
Transcript: ENSMUST00000049648
AA Change: H324L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050183
Gene: ENSMUSG00000025893
AA Change: H324L

DomainStartEndE-ValueType
BTB 48 145 1.83e-23 SMART
BACK 150 252 1.19e-26 SMART
Blast:Kelch 292 338 7e-15 BLAST
Kelch 339 399 2.56e0 SMART
Kelch 400 450 8.67e-4 SMART
Kelch 548 597 3.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212221
AA Change: H324L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 C T 16: 45,731,774 W245* probably null Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bpifb6 A G 2: 153,908,141 probably benign Het
Cmtr2 T C 8: 110,221,754 V232A probably damaging Het
Cmya5 A T 13: 93,092,487 M2031K probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Fgfr2 G A 7: 130,182,757 T270M probably damaging Het
Hoxd10 C T 2: 74,694,130 T262I probably damaging Het
Htt G A 5: 34,811,522 probably benign Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nxpe5 T C 5: 138,251,624 S559P probably damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr826 T A 10: 130,180,500 I127F possibly damaging Het
Ptx3 G T 3: 66,224,955 S299I probably benign Het
Rbbp4 T A 4: 129,328,632 D89V probably benign Het
Rfx4 A G 10: 84,880,224 E375G probably damaging Het
Senp7 T A 16: 56,179,057 probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Skiv2l2 A G 13: 112,895,595 F561S probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spata18 A T 5: 73,666,850 probably null Het
St8sia6 T C 2: 13,656,934 N362S possibly damaging Het
Tmub2 G T 11: 102,285,061 probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ttn T C 2: 76,944,710 D1996G possibly damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vdac1 A G 11: 52,376,646 probably null Het
Vps51 G A 19: 6,077,168 probably benign Het
Zfp90 A G 8: 106,424,050 R132G probably benign Het
Other mutations in Kbtbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Kbtbd3 APN 9 4330169 missense probably benign
IGL00674:Kbtbd3 APN 9 4329949 missense probably benign 0.05
IGL00848:Kbtbd3 APN 9 4331184 missense probably damaging 1.00
IGL01949:Kbtbd3 APN 9 4331066 missense possibly damaging 0.95
IGL02619:Kbtbd3 APN 9 4331252 missense probably damaging 1.00
IGL02830:Kbtbd3 APN 9 4330096 missense possibly damaging 0.95
IGL02894:Kbtbd3 APN 9 4331444 missense probably benign 0.05
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0348:Kbtbd3 UTSW 9 4330519 missense possibly damaging 0.94
R0372:Kbtbd3 UTSW 9 4316950 missense possibly damaging 0.75
R0380:Kbtbd3 UTSW 9 4330545 nonsense probably null
R0644:Kbtbd3 UTSW 9 4329868 missense probably damaging 1.00
R1496:Kbtbd3 UTSW 9 4330276 missense probably benign
R1651:Kbtbd3 UTSW 9 4330589 missense possibly damaging 0.62
R1707:Kbtbd3 UTSW 9 4316985 missense probably benign 0.01
R1998:Kbtbd3 UTSW 9 4330760 missense probably benign 0.01
R2012:Kbtbd3 UTSW 9 4330919 missense probably benign
R2027:Kbtbd3 UTSW 9 4317075 splice site probably benign
R4463:Kbtbd3 UTSW 9 4331257 missense probably damaging 0.99
R4482:Kbtbd3 UTSW 9 4331051 missense probably damaging 1.00
R4795:Kbtbd3 UTSW 9 4331073 nonsense probably null
R5195:Kbtbd3 UTSW 9 4316905 missense possibly damaging 0.74
R5645:Kbtbd3 UTSW 9 4331426 missense possibly damaging 0.92
R5753:Kbtbd3 UTSW 9 4331404 missense possibly damaging 0.74
R5898:Kbtbd3 UTSW 9 4330476 missense probably damaging 0.97
R6463:Kbtbd3 UTSW 9 4316921 missense probably benign
R6681:Kbtbd3 UTSW 9 4330687 missense probably benign 0.00
R7284:Kbtbd3 UTSW 9 4330690 nonsense probably null
R7390:Kbtbd3 UTSW 9 4330424 missense probably benign 0.27
R7735:Kbtbd3 UTSW 9 4330846 missense possibly damaging 0.89
R7793:Kbtbd3 UTSW 9 4331221 missense probably damaging 1.00
R8005:Kbtbd3 UTSW 9 4330655 missense not run
R8050:Kbtbd3 UTSW 9 4330408 missense not run
X0024:Kbtbd3 UTSW 9 4331437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATCGTGGATGCCATTAAGTGTG -3'
(R):5'- TTGAGAGCCATGACTGATGTATG -3'

Sequencing Primer
(F):5'- GCCATTAAGTGTGTACAAGGTTC -3'
(R):5'- AGCCATGACTGATGTATGCATGG -3'
Posted On2015-01-23