Incidental Mutation 'R3717:Ano6'
ID259973
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission 040709-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R3717 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95913379 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 120 (D120G)
Ref Sequence ENSEMBL: ENSMUSP00000153853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000226793] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: D120G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: D120G

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226793
AA Change: D106G

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000227151
AA Change: D120G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: D141G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.1803 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 C T 16: 45,731,774 W245* probably null Het
Alas2 T C X: 150,560,730 probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bpifb6 A G 2: 153,908,141 probably benign Het
Cmtr2 T C 8: 110,221,754 V232A probably damaging Het
Cmya5 A T 13: 93,092,487 M2031K probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Fgfr2 G A 7: 130,182,757 T270M probably damaging Het
Hoxd10 C T 2: 74,694,130 T262I probably damaging Het
Htt G A 5: 34,811,522 probably benign Het
Kbtbd3 A T 9: 4,330,598 H324L probably benign Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nxpe5 T C 5: 138,251,624 S559P probably damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr826 T A 10: 130,180,500 I127F possibly damaging Het
Ptx3 G T 3: 66,224,955 S299I probably benign Het
Rbbp4 T A 4: 129,328,632 D89V probably benign Het
Rfx4 A G 10: 84,880,224 E375G probably damaging Het
Senp7 T A 16: 56,179,057 probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Skiv2l2 A G 13: 112,895,595 F561S probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spata18 A T 5: 73,666,850 probably null Het
St8sia6 T C 2: 13,656,934 N362S possibly damaging Het
Tmub2 G T 11: 102,285,061 probably benign Het
Ttn T C 2: 76,944,710 D1996G possibly damaging Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vdac1 A G 11: 52,376,646 probably null Het
Vps51 G A 19: 6,077,168 probably benign Het
Zfp90 A G 8: 106,424,050 R132G probably benign Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGACAAATATACAGTGTGC -3'
(R):5'- ATGACACTCTCGTTCACCCG -3'

Sequencing Primer
(F):5'- ATGCTAGCTCCATGGAATCTGGC -3'
(R):5'- CGGAGGACCTTGGTGAAC -3'
Posted On2015-01-23