Incidental Mutation 'R3717:Alas2'
ID259980
Institutional Source Beutler Lab
Gene Symbol Alas2
Ensembl Gene ENSMUSG00000025270
Gene Nameaminolevulinic acid synthase 2, erythroid
Synonyms5-aminolevulinate synthase, ALAS-E, ALASE, ALAS, erythroid-specific ALAS, Alas-2
MMRRC Submission 040709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3717 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location150547375-150570638 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 150560730 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066337] [ENSMUST00000112715] [ENSMUST00000112725] [ENSMUST00000112727]
Predicted Effect probably benign
Transcript: ENSMUST00000066337
SMART Domains Protein: ENSMUSP00000066040
Gene: ENSMUSG00000025270

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 49 100 1.4e-10 PFAM
Pfam:Aminotran_1_2 189 536 5.4e-78 PFAM
Pfam:Aminotran_5 203 367 2.4e-10 PFAM
Pfam:Cys_Met_Meta_PP 226 368 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112715
SMART Domains Protein: ENSMUSP00000108335
Gene: ENSMUSG00000025270

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 86 4.7e-30 PFAM
Pfam:Aminotran_1_2 174 521 3e-78 PFAM
Pfam:Aminotran_5 188 352 1.1e-11 PFAM
Pfam:Cys_Met_Meta_PP 212 354 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112725
SMART Domains Protein: ENSMUSP00000108345
Gene: ENSMUSG00000025269

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 5 258 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112727
SMART Domains Protein: ENSMUSP00000108347
Gene: ENSMUSG00000025269

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 5 260 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134670
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene specifies an erythroid-specific mitochondrially located enzyme. The encoded protein catalyzes the first step in the heme biosynthetic pathway. Defects in this gene cause X-linked pyridoxine-responsive sideroblastic anemia. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality and severe anemia due to arrest of fetal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 C T 16: 45,731,774 W245* probably null Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bpifb6 A G 2: 153,908,141 probably benign Het
Cmtr2 T C 8: 110,221,754 V232A probably damaging Het
Cmya5 A T 13: 93,092,487 M2031K probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Fgfr2 G A 7: 130,182,757 T270M probably damaging Het
Hoxd10 C T 2: 74,694,130 T262I probably damaging Het
Htt G A 5: 34,811,522 probably benign Het
Kbtbd3 A T 9: 4,330,598 H324L probably benign Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nxpe5 T C 5: 138,251,624 S559P probably damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr826 T A 10: 130,180,500 I127F possibly damaging Het
Ptx3 G T 3: 66,224,955 S299I probably benign Het
Rbbp4 T A 4: 129,328,632 D89V probably benign Het
Rfx4 A G 10: 84,880,224 E375G probably damaging Het
Senp7 T A 16: 56,179,057 probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Skiv2l2 A G 13: 112,895,595 F561S probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spata18 A T 5: 73,666,850 probably null Het
St8sia6 T C 2: 13,656,934 N362S possibly damaging Het
Tmub2 G T 11: 102,285,061 probably benign Het
Ttn T C 2: 76,944,710 D1996G possibly damaging Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vdac1 A G 11: 52,376,646 probably null Het
Vps51 G A 19: 6,077,168 probably benign Het
Zfp90 A G 8: 106,424,050 R132G probably benign Het
Other mutations in Alas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03227:Alas2 APN X 150557266 missense probably damaging 1.00
R3718:Alas2 UTSW X 150560730 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGAAACTGAATTTCTCCTCCCC -3'
(R):5'- TGGAATGAACAGTCTCAAAAGCC -3'

Sequencing Primer
(F):5'- ACAGCAGTTAGGCATCCTTG -3'
(R):5'- AAAGCCACAATTTTTGGTGTCTTGG -3'
Posted On2015-01-23