Incidental Mutation 'R2888:Kansl1l'
ID259981
Institutional Source Beutler Lab
Gene Symbol Kansl1l
Ensembl Gene ENSMUSG00000026004
Gene NameKAT8 regulatory NSL complex subunit 1-like
Synonyms1110028C15Rik, C430010P07Rik
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R2888 (G1)
Quality Score215
Status Validated
Chromosome1
Chromosomal Location66719248-66817562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66724605 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 762 (K762E)
Ref Sequence ENSEMBL: ENSMUSP00000063843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027157] [ENSMUST00000068168] [ENSMUST00000113995] [ENSMUST00000142920]
Predicted Effect probably benign
Transcript: ENSMUST00000027157
SMART Domains Protein: ENSMUSP00000027157
Gene: ENSMUSG00000026005

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 204 1.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068168
AA Change: K762E

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004
AA Change: K762E

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
PEHE 755 875 2.42e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113995
SMART Domains Protein: ENSMUSP00000109628
Gene: ENSMUSG00000026005

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 208 1.1e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129190
AA Change: K461E
SMART Domains Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004
AA Change: K461E

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 174 191 N/A INTRINSIC
PEHE 455 575 2.42e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142920
SMART Domains Protein: ENSMUSP00000137941
Gene: ENSMUSG00000026005

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 49 3.6e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Kansl1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Kansl1l APN 1 66724574 missense possibly damaging 0.83
IGL00825:Kansl1l APN 1 66801512 missense probably benign
IGL01644:Kansl1l APN 1 66801316 missense probably benign 0.01
IGL01690:Kansl1l APN 1 66801073 missense probably damaging 0.98
IGL01811:Kansl1l APN 1 66723303 missense probably damaging 1.00
IGL01966:Kansl1l APN 1 66738068 missense probably damaging 1.00
IGL02549:Kansl1l APN 1 66801968 missense probably benign 0.44
IGL02578:Kansl1l APN 1 66801689 nonsense probably null
IGL02707:Kansl1l APN 1 66773445 missense probably damaging 1.00
IGL03088:Kansl1l APN 1 66735725 missense probably damaging 0.98
IGL03187:Kansl1l APN 1 66725903 missense probably damaging 1.00
IGL03279:Kansl1l APN 1 66735666 missense probably damaging 0.99
arkansasii UTSW 1 66762103 missense probably damaging 1.00
Kansasii UTSW 1 66778106 missense probably null 0.41
PIT4810001:Kansl1l UTSW 1 66762149 missense probably damaging 1.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0070:Kansl1l UTSW 1 66801103 missense probably damaging 0.99
R0312:Kansl1l UTSW 1 66778106 missense probably null 0.41
R0456:Kansl1l UTSW 1 66735726 missense probably damaging 0.99
R0720:Kansl1l UTSW 1 66801356 missense possibly damaging 0.52
R1381:Kansl1l UTSW 1 66720904 missense probably benign 0.01
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1759:Kansl1l UTSW 1 66801888 missense probably damaging 0.96
R1840:Kansl1l UTSW 1 66778032 missense probably damaging 1.00
R2299:Kansl1l UTSW 1 66773477 missense probably damaging 1.00
R2893:Kansl1l UTSW 1 66801334 missense probably damaging 1.00
R3735:Kansl1l UTSW 1 66801250 missense possibly damaging 0.90
R4249:Kansl1l UTSW 1 66773478 missense probably damaging 1.00
R4448:Kansl1l UTSW 1 66738159 missense probably damaging 0.99
R4710:Kansl1l UTSW 1 66801496 missense possibly damaging 0.66
R4768:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R5523:Kansl1l UTSW 1 66802112 missense probably benign 0.00
R5645:Kansl1l UTSW 1 66801344 missense probably benign 0.27
R5840:Kansl1l UTSW 1 66770215 intron probably benign
R5964:Kansl1l UTSW 1 66725922 missense probably damaging 1.00
R5990:Kansl1l UTSW 1 66735726 missense probably damaging 0.98
R6009:Kansl1l UTSW 1 66735600 missense probably benign 0.00
R6051:Kansl1l UTSW 1 66726726 missense probably null 1.00
R6092:Kansl1l UTSW 1 66773484 missense probably damaging 1.00
R6316:Kansl1l UTSW 1 66735585 missense probably benign
R6402:Kansl1l UTSW 1 66762193 missense probably damaging 0.99
R6906:Kansl1l UTSW 1 66723278 missense possibly damaging 0.76
R7241:Kansl1l UTSW 1 66801628 missense possibly damaging 0.91
R7434:Kansl1l UTSW 1 66762103 missense probably damaging 1.00
R7716:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R7793:Kansl1l UTSW 1 66778014 missense probably damaging 1.00
R8187:Kansl1l UTSW 1 66801737 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGGCTTGGAGGATACACTATGC -3'
(R):5'- TGGGTTAATTCAAAACCAGCAC -3'

Sequencing Primer
(F):5'- GCTTGGAGGATACACTATGCTATATG -3'
(R):5'- TTCAAAACCAGCACATAATTTGAAC -3'
Posted On2015-01-23