Incidental Mutation 'R2888:Rbm39'
ID259983
Institutional Source Beutler Lab
Gene Symbol Rbm39
Ensembl Gene ENSMUSG00000027620
Gene NameRNA binding motif protein 39
SynonymsB330012G18Rik, Caper alpha, 1500012C14Rik, caper, Rnpc2, 2310040E03Rik
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156147239-156180238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156167583 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 123 (R123H)
Ref Sequence ENSEMBL: ENSMUSP00000116950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029149] [ENSMUST00000109587] [ENSMUST00000126992] [ENSMUST00000142071] [ENSMUST00000146288] [ENSMUST00000146297] [ENSMUST00000153514] [ENSMUST00000155837]
Predicted Effect probably benign
Transcript: ENSMUST00000029149
AA Change: R124H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029149
Gene: ENSMUSG00000027620
AA Change: R124H

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109587
AA Change: R124H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105216
Gene: ENSMUSG00000027620
AA Change: R124H

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 403 422 N/A INTRINSIC
RRM 425 504 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126992
AA Change: R123H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000116950
Gene: ENSMUSG00000027620
AA Change: R123H

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 135 N/A INTRINSIC
RRM 153 225 2.5e-15 SMART
PDB:2JRS|A 239 273 9e-18 PDB
Blast:RRM 250 273 4e-9 BLAST
SCOP:d1l3ka1 250 273 9e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140001
Predicted Effect probably benign
Transcript: ENSMUST00000142071
AA Change: R124H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116820
Gene: ENSMUSG00000027620
AA Change: R124H

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
Pfam:RBM39linker 339 404 3.8e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146288
AA Change: R102H
SMART Domains Protein: ENSMUSP00000114824
Gene: ENSMUSG00000027620
AA Change: R102H

DomainStartEndE-ValueType
low complexity region 27 114 N/A INTRINSIC
PDB:2CQ4|A 115 156 2e-21 PDB
Blast:RRM 132 156 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146297
AA Change: R124H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119298
Gene: ENSMUSG00000027620
AA Change: R124H

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148794
SMART Domains Protein: ENSMUSP00000117462
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
RRM 16 88 2.5e-15 SMART
RRM 113 164 2.45e-9 SMART
Pfam:RBM39linker 181 282 6.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150272
Predicted Effect probably benign
Transcript: ENSMUST00000153514
Predicted Effect probably benign
Transcript: ENSMUST00000155837
Meta Mutation Damage Score 0.1311 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U2AF65 family of proteins. The encoded protein is found in the nucleus, where it co-localizes with core spliceosomal proteins. It has been shown to play a role in both steroid hormone receptor-mediated transcription and alternative splicing, and it is also a transcriptional coregulator of the viral oncoprotein v-Rel. Multiple transcript variants have been observed for this gene. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous disruption of this locus results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Rbm39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Rbm39 APN 2 156162871 missense probably damaging 1.00
IGL01473:Rbm39 APN 2 156172979 nonsense probably null
R0040:Rbm39 UTSW 2 156148179 missense possibly damaging 0.90
R1564:Rbm39 UTSW 2 156154257 missense probably benign 0.01
R4872:Rbm39 UTSW 2 156177346 missense possibly damaging 0.94
R5124:Rbm39 UTSW 2 156159162 missense probably damaging 0.99
R5125:Rbm39 UTSW 2 156162865 missense probably damaging 0.99
R5843:Rbm39 UTSW 2 156162873 missense possibly damaging 0.84
R6714:Rbm39 UTSW 2 156161618 missense possibly damaging 0.82
R6820:Rbm39 UTSW 2 156179226 start codon destroyed probably null 0.66
R6970:Rbm39 UTSW 2 156167584 missense probably damaging 1.00
R8178:Rbm39 UTSW 2 156154275 missense probably benign 0.00
R8701:Rbm39 UTSW 2 156161587 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCTTACTGAGGCATAAAC -3'
(R):5'- GCTCCGGACCAAAATTTAACAG -3'

Sequencing Primer
(F):5'- CCAGATGGTCTACAGAGTGAGTTCC -3'
(R):5'- TTTAACAGTGCCATCCGAGG -3'
Posted On2015-01-23