Incidental Mutation 'R2888:Gm13089'
ID259986
Institutional Source Beutler Lab
Gene Symbol Gm13089
Ensembl Gene ENSMUSG00000070617
Gene Namepredicted gene 13089
Synonyms
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143696500-143702711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 143696890 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 443 (T443K)
Ref Sequence ENSEMBL: ENSMUSP00000073224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073532]
Predicted Effect probably benign
Transcript: ENSMUST00000073532
AA Change: T443K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000073224
Gene: ENSMUSG00000070617
AA Change: T443K

DomainStartEndE-ValueType
low complexity region 204 216 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Gm13089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Gm13089 APN 4 143696840 utr 3 prime probably benign
IGL02087:Gm13089 APN 4 143697074 missense probably damaging 0.96
IGL02296:Gm13089 APN 4 143698481 nonsense probably null
IGL02902:Gm13089 APN 4 143698343 missense probably damaging 1.00
IGL02903:Gm13089 APN 4 143699166 missense probably benign 0.04
IGL02962:Gm13089 APN 4 143697340 missense probably benign 0.28
IGL03351:Gm13089 APN 4 143697088 missense possibly damaging 0.80
R0122:Gm13089 UTSW 4 143698404 missense probably benign 0.44
R0533:Gm13089 UTSW 4 143698020 nonsense probably null
R0609:Gm13089 UTSW 4 143698503 missense probably benign 0.00
R0743:Gm13089 UTSW 4 143698564 missense probably damaging 0.97
R0744:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R0833:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R1052:Gm13089 UTSW 4 143696907 missense possibly damaging 0.81
R1690:Gm13089 UTSW 4 143698123 missense probably benign 0.03
R1764:Gm13089 UTSW 4 143698270 missense probably benign 0.14
R1896:Gm13089 UTSW 4 143698144 missense probably benign 0.11
R2084:Gm13089 UTSW 4 143699350 missense probably damaging 1.00
R2178:Gm13089 UTSW 4 143698042 missense possibly damaging 0.95
R3759:Gm13089 UTSW 4 143697151 missense probably damaging 1.00
R4193:Gm13089 UTSW 4 143698333 missense probably damaging 1.00
R4380:Gm13089 UTSW 4 143698286 missense probably benign 0.21
R4385:Gm13089 UTSW 4 143698014 critical splice donor site probably null
R4513:Gm13089 UTSW 4 143698148 missense probably benign 0.00
R4647:Gm13089 UTSW 4 143699344 missense probably benign 0.00
R4920:Gm13089 UTSW 4 143699283 missense probably benign 0.05
R4994:Gm13089 UTSW 4 143698369 missense possibly damaging 0.94
R5197:Gm13089 UTSW 4 143698062 missense possibly damaging 0.86
R6005:Gm13089 UTSW 4 143698432 missense probably benign 0.00
R6073:Gm13089 UTSW 4 143698268 missense probably damaging 0.99
R6197:Gm13089 UTSW 4 143697316 missense possibly damaging 0.90
R6264:Gm13089 UTSW 4 143699152 missense possibly damaging 0.50
R6821:Gm13089 UTSW 4 143699304 nonsense probably null
R6923:Gm13089 UTSW 4 143699106 missense probably benign 0.06
R7034:Gm13089 UTSW 4 143697328 missense probably damaging 1.00
R7140:Gm13089 UTSW 4 143698432 missense probably benign 0.01
R7298:Gm13089 UTSW 4 143698505 missense probably benign 0.23
R7529:Gm13089 UTSW 4 143702674
R7766:Gm13089 UTSW 4 143699239 missense probably damaging 0.98
R7774:Gm13089 UTSW 4 143697106 missense possibly damaging 0.89
R7816:Gm13089 UTSW 4 143698194 missense probably benign 0.00
Z1088:Gm13089 UTSW 4 143698080 missense probably benign
Z1176:Gm13089 UTSW 4 143696945 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTCTAGTGTGTCTCAGAC -3'
(R):5'- AGTGTTGCCAACTCACAGAAG -3'

Sequencing Primer
(F):5'- CCTCTAGTGTGTCTCAGACATTTAGG -3'
(R):5'- GTTGCCAACTCACAGAAGTCAATTTC -3'
Posted On2015-01-23