Incidental Mutation 'R2888:Gusb'
ID259989
Institutional Source Beutler Lab
Gene Symbol Gusb
Ensembl Gene ENSMUSG00000025534
Gene Nameglucuronidase, beta
SynonymsGut, Gus, asd, Gur, g, Gus-s, Gus-r, adipose storage deficiency, Gus-u, Gus-t
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129989011-130003049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130000502 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 146 (H146R)
Ref Sequence ENSEMBL: ENSMUSP00000026613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026613] [ENSMUST00000111307] [ENSMUST00000111308] [ENSMUST00000201801]
Predicted Effect probably damaging
Transcript: ENSMUST00000026613
AA Change: H146R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026613
Gene: ENSMUSG00000025534
AA Change: H146R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 4e-46 PFAM
Pfam:Glyco_hydro_2 225 323 6.4e-12 PFAM
Pfam:Glyco_hydro_2_C 325 627 9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111307
SMART Domains Protein: ENSMUSP00000106939
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 143 2.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111308
AA Change: H146R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106940
Gene: ENSMUSG00000025534
AA Change: H146R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 7.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122994
Predicted Effect probably benign
Transcript: ENSMUST00000201801
SMART Domains Protein: ENSMUSP00000144478
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 138 5.5e-19 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that degrades glycosaminoglycans, including heparan sulfate, dermatan sulfate, and chondroitin-4,6-sulfate. The enzyme forms a homotetramer that is localized to the lysosome. Mutations in this gene result in mucopolysaccharidosis type VII. Alternative splicing results in multiple transcript variants. There are many pseudogenes of this locus in the human genome.[provided by RefSeq, May 2014]
PHENOTYPE: Knock-in mutations of this gene lead to lysosomal storage disease and may cause premature death, facial, tail and limb anomalies, growth retardation, male sterility, reduced lactation, osteosclerosis and behavioral defects. Additional phenotypes include partial neonatal death and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Gusb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gusb APN 5 129999381 missense probably damaging 1.00
IGL01561:Gusb APN 5 129998086 missense probably damaging 1.00
IGL02642:Gusb APN 5 130000535 splice site probably null
IGL03307:Gusb APN 5 130000031 makesense probably null
R0389:Gusb UTSW 5 129998086 missense probably damaging 1.00
R1496:Gusb UTSW 5 129998544 missense probably benign 0.00
R1512:Gusb UTSW 5 130000890 missense probably damaging 1.00
R2125:Gusb UTSW 5 129999447 missense probably benign 0.00
R2890:Gusb UTSW 5 130000502 missense probably damaging 1.00
R3017:Gusb UTSW 5 130000484 missense probably damaging 1.00
R4453:Gusb UTSW 5 129998483 missense possibly damaging 0.84
R4906:Gusb UTSW 5 129998118 missense probably damaging 0.98
R4937:Gusb UTSW 5 129995485 missense probably damaging 0.99
R5260:Gusb UTSW 5 129999988 nonsense probably null
R5281:Gusb UTSW 5 129998526 missense probably benign 0.00
R6194:Gusb UTSW 5 129990065 missense possibly damaging 0.46
R6248:Gusb UTSW 5 130000525 missense probably benign 0.01
R7121:Gusb UTSW 5 130000043 missense probably benign 0.44
R7209:Gusb UTSW 5 129998546 missense probably benign
R7768:Gusb UTSW 5 130000405 missense probably benign 0.01
R8223:Gusb UTSW 5 129990112 missense probably benign 0.00
Z1177:Gusb UTSW 5 130002736 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCTAGAACCATTCTCCCTATGG -3'
(R):5'- AGAAGGGCTCTGTGTCATGG -3'

Sequencing Primer
(F):5'- CCTATGGGGAAGTCTGCTGG -3'
(R):5'- CTCTGTGTCATGGGTCAGAGAAG -3'
Posted On2015-01-23