Incidental Mutation 'R2888:Llcfc1'
ID259992
Institutional Source Beutler Lab
Gene Symbol Llcfc1
Ensembl Gene ENSMUSG00000029867
Gene NameLLLL and CFNLAS motif containing 1
Synonyms1700034O15Rik
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41684431-41685717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41684603 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 29 (K29M)
Ref Sequence ENSEMBL: ENSMUSP00000031900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000031901] [ENSMUST00000193503] [ENSMUST00000194597]
Predicted Effect probably benign
Transcript: ENSMUST00000031899
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031900
AA Change: K29M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867
AA Change: K29M

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF4717 37 107 7.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031901
SMART Domains Protein: ENSMUSP00000031901
Gene: ENSMUSG00000036899

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 2.3e0 SMART
ANK 110 139 4.56e-4 SMART
ANK 156 185 1.85e-4 SMART
Blast:ANK 189 217 3e-10 BLAST
ANK 232 261 3.07e2 SMART
Pfam:Ion_trans 321 583 1.8e-19 PFAM
low complexity region 676 691 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153760
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Predicted Effect probably benign
Transcript: ENSMUST00000193503
SMART Domains Protein: ENSMUSP00000141421
Gene: ENSMUSG00000036899

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 1.5e-2 SMART
ANK 110 139 2.8e-6 SMART
ANK 156 185 1.2e-6 SMART
Blast:ANK 189 217 4e-10 BLAST
transmembrane domain 274 296 N/A INTRINSIC
Pfam:Ion_trans 335 522 2.7e-12 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194597
SMART Domains Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
Pfam:Peptidase_M13 16 68 3.6e-10 PFAM
Meta Mutation Damage Score 0.4283 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Llcfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Llcfc1 APN 6 41684525 missense possibly damaging 0.95
IGL02936:Llcfc1 APN 6 41684659 missense probably benign 0.23
Emaciated UTSW 6 41684603 missense probably damaging 0.98
gaunt UTSW 6 41685376 missense probably benign
R1482:Llcfc1 UTSW 6 41685284 missense probably damaging 1.00
R2148:Llcfc1 UTSW 6 41685221 missense possibly damaging 0.79
R5053:Llcfc1 UTSW 6 41685335 missense possibly damaging 0.93
R5106:Llcfc1 UTSW 6 41685376 missense probably benign
R7149:Llcfc1 UTSW 6 41685317 missense possibly damaging 0.88
R8909:Llcfc1 UTSW 6 41684591 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATGGCAGCGATGTCATAGGAC -3'
(R):5'- ATGACCTAGTCTGCTGCTGG -3'

Sequencing Primer
(F):5'- CACATAGAATCAGAGGTCCTATGG -3'
(R):5'- CTGGAGCCTGATGTGAATCC -3'
Posted On2015-01-23