Incidental Mutation 'R2888:Plekha4'
ID259995
Institutional Source Beutler Lab
Gene Symbol Plekha4
Ensembl Gene ENSMUSG00000040428
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms2410005C22Rik, PEPP1
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45526330-45554229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45538244 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 176 (R176C)
Ref Sequence ENSEMBL: ENSMUSP00000147344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000209517] [ENSMUST00000211155] [ENSMUST00000211227] [ENSMUST00000211797]
Predicted Effect probably damaging
Transcript: ENSMUST00000051810
AA Change: R247C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428
AA Change: R247C

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120516
AA Change: R247C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114138
Gene: ENSMUSG00000040428
AA Change: R247C

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 308 328 N/A INTRINSIC
coiled coil region 348 391 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120985
AA Change: R247C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112856
Gene: ENSMUSG00000040428
AA Change: R247C

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121932
AA Change: R247C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113802
Gene: ENSMUSG00000040428
AA Change: R247C

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149052
AA Change: R176C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123030
Gene: ENSMUSG00000040428
AA Change: R176C

DomainStartEndE-ValueType
Blast:PH 49 84 4e-13 BLAST
PDB:1UPR|A 49 89 2e-16 PDB
SCOP:d1btn__ 54 80 1e-4 SMART
low complexity region 91 119 N/A INTRINSIC
low complexity region 157 189 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
low complexity region 250 263 N/A INTRINSIC
coiled coil region 305 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209517
AA Change: R247C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211155
AA Change: R247C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211227
AA Change: R247C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211794
Predicted Effect probably damaging
Transcript: ENSMUST00000211797
AA Change: R176C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Plekha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Plekha4 APN 7 45538235 missense probably damaging 0.97
IGL01716:Plekha4 APN 7 45534343 missense probably damaging 0.98
IGL02072:Plekha4 APN 7 45538298 missense probably benign 0.29
IGL02815:Plekha4 APN 7 45538412 missense probably damaging 1.00
IGL02939:Plekha4 APN 7 45532363 nonsense probably null
PIT4494001:Plekha4 UTSW 7 45548079 missense probably damaging 1.00
R0085:Plekha4 UTSW 7 45543949 nonsense probably null
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R0239:Plekha4 UTSW 7 45532358 missense probably damaging 1.00
R1036:Plekha4 UTSW 7 45549976 splice site probably benign
R1955:Plekha4 UTSW 7 45553906 missense probably damaging 0.99
R2049:Plekha4 UTSW 7 45553798 missense probably benign 0.01
R2187:Plekha4 UTSW 7 45549274 missense probably damaging 0.99
R5086:Plekha4 UTSW 7 45553658 missense possibly damaging 0.82
R5357:Plekha4 UTSW 7 45534771 missense probably damaging 1.00
R5604:Plekha4 UTSW 7 45549156 missense probably damaging 0.96
R5611:Plekha4 UTSW 7 45553641 missense probably benign
R6255:Plekha4 UTSW 7 45553802 utr 3 prime probably benign
R6341:Plekha4 UTSW 7 45541148 missense probably damaging 1.00
R6502:Plekha4 UTSW 7 45530576 start codon destroyed probably null 0.87
R6720:Plekha4 UTSW 7 45540886 missense possibly damaging 0.86
R6776:Plekha4 UTSW 7 45534817 missense probably damaging 1.00
R8057:Plekha4 UTSW 7 45549271 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGATGCATATATTCCCAAAGGG -3'
(R):5'- GTGGGAAATGTAGTCTGCTCC -3'

Sequencing Primer
(F):5'- GGAACACACCCACTCTGCCTAG -3'
(R):5'- AAATGTAGTCTGCTCCTTTCGAG -3'
Posted On2015-01-23