Incidental Mutation 'R2888:Lamp1'
ID259999
Institutional Source Beutler Lab
Gene Symbol Lamp1
Ensembl Gene ENSMUSG00000031447
Gene Namelysosomal-associated membrane protein 1
SynonymsLamp-1, CD107a
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2888 (G1)
Quality Score182
Status Validated
Chromosome8
Chromosomal Location13159161-13175338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13173891 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 341 (L341H)
Ref Sequence ENSEMBL: ENSMUSP00000033824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033824] [ENSMUST00000165605] [ENSMUST00000209691] [ENSMUST00000209895] [ENSMUST00000210317] [ENSMUST00000211128]
Predicted Effect probably damaging
Transcript: ENSMUST00000033824
AA Change: L341H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033824
Gene: ENSMUSG00000031447
AA Change: L341H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Lamp 106 406 4.8e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165605
SMART Domains Protein: ENSMUSP00000130324
Gene: ENSMUSG00000038515

DomainStartEndE-ValueType
TBC 71 287 2.03e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209465
Predicted Effect probably benign
Transcript: ENSMUST00000209516
Predicted Effect probably benign
Transcript: ENSMUST00000209691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209709
Predicted Effect probably benign
Transcript: ENSMUST00000209895
Predicted Effect probably benign
Transcript: ENSMUST00000210317
Predicted Effect probably benign
Transcript: ENSMUST00000211128
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may also play a role in tumor cell metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Lamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Lamp1 APN 8 13171195 unclassified probably benign
IGL01516:Lamp1 APN 8 13173863 missense probably damaging 0.98
IGL01541:Lamp1 APN 8 13165905 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0127:Lamp1 UTSW 8 13174491 missense probably damaging 1.00
R0744:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R0836:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R1875:Lamp1 UTSW 8 13167257 missense probably damaging 1.00
R1945:Lamp1 UTSW 8 13172545 missense probably benign 0.40
R2887:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2889:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2890:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R4235:Lamp1 UTSW 8 13167192 missense possibly damaging 0.66
R4817:Lamp1 UTSW 8 13172541 missense probably benign 0.43
R5654:Lamp1 UTSW 8 13171388 splice site probably null
R5942:Lamp1 UTSW 8 13173941 missense probably damaging 1.00
R6538:Lamp1 UTSW 8 13171285 missense probably benign 0.00
R6917:Lamp1 UTSW 8 13172563 missense probably damaging 1.00
R6977:Lamp1 UTSW 8 13173661 missense probably damaging 0.98
R7262:Lamp1 UTSW 8 13167296 missense probably benign 0.01
R7680:Lamp1 UTSW 8 13167812 missense probably benign
R8123:Lamp1 UTSW 8 13167158 missense probably benign
R8697:Lamp1 UTSW 8 13174448 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTCCTGATGCCCTAGGTGAG -3'
(R):5'- CCTGTCTTTGCAGAGGAAAAG -3'

Sequencing Primer
(F):5'- TAGGTGAGACTGGCTTCCTCC -3'
(R):5'- TGCTACTTACCAGACCCA -3'
Posted On2015-01-23