Incidental Mutation 'R2888:Acd'
ID260000
Institutional Source Beutler Lab
Gene Symbol Acd
Ensembl Gene ENSMUSG00000038000
Gene Nameadrenocortical dysplasia
Synonyms
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105695860-105701102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105698838 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 288 (S288P)
Ref Sequence ENSEMBL: ENSMUSP00000048180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013299] [ENSMUST00000042608] [ENSMUST00000062574] [ENSMUST00000093195] [ENSMUST00000098444] [ENSMUST00000211870] [ENSMUST00000211888] [ENSMUST00000212061] [ENSMUST00000212352] [ENSMUST00000212430] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000213019]
Predicted Effect probably benign
Transcript: ENSMUST00000013299
SMART Domains Protein: ENSMUSP00000013299
Gene: ENSMUSG00000013155

DomainStartEndE-ValueType
low complexity region 220 236 N/A INTRINSIC
Pfam:Enkurin 243 339 6.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042608
AA Change: S288P

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000
AA Change: S288P

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062574
SMART Domains Protein: ENSMUSP00000052322
Gene: ENSMUSG00000050357

DomainStartEndE-ValueType
Pfam:CARMIL_C 149 442 3.3e-62 PFAM
low complexity region 467 484 N/A INTRINSIC
low complexity region 631 659 N/A INTRINSIC
low complexity region 696 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093195
SMART Domains Protein: ENSMUSP00000090886
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 15 95 2.81e-15 SMART
PDZ 167 250 1.38e-12 SMART
low complexity region 263 286 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098444
SMART Domains Protein: ENSMUSP00000096043
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 4 79 1.28e-9 SMART
PDZ 151 234 1.38e-12 SMART
low complexity region 247 270 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211870
Predicted Effect probably benign
Transcript: ENSMUST00000211888
Predicted Effect probably benign
Transcript: ENSMUST00000212061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212162
Predicted Effect probably benign
Transcript: ENSMUST00000212352
Predicted Effect probably benign
Transcript: ENSMUST00000212430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212634
Predicted Effect probably benign
Transcript: ENSMUST00000212642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212643
Predicted Effect probably benign
Transcript: ENSMUST00000212650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212716
Predicted Effect probably benign
Transcript: ENSMUST00000213019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212687
Meta Mutation Damage Score 0.2529 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce skeletal, coat, vibrissae and skin pigmentation defects. Kidney and adrenal abnormalities cause a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Acd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Acd APN 8 105698454 missense probably damaging 1.00
IGL02322:Acd APN 8 105698636 missense probably benign 0.04
R0613:Acd UTSW 8 105700568 splice site probably null
R1750:Acd UTSW 8 105698892 missense possibly damaging 0.93
R1824:Acd UTSW 8 105700490 missense probably damaging 1.00
R1870:Acd UTSW 8 105698407 critical splice donor site probably null
R2945:Acd UTSW 8 105700295 nonsense probably null
R3001:Acd UTSW 8 105700281 critical splice donor site probably null
R3002:Acd UTSW 8 105700281 critical splice donor site probably null
R3003:Acd UTSW 8 105700281 critical splice donor site probably null
R4795:Acd UTSW 8 105701015 missense possibly damaging 0.92
R4806:Acd UTSW 8 105698290 missense possibly damaging 0.75
R6111:Acd UTSW 8 105698287 missense probably benign 0.04
R6236:Acd UTSW 8 105700495 missense probably benign 0.01
R7096:Acd UTSW 8 105698489 missense possibly damaging 0.52
R8677:Acd UTSW 8 105700944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGAGAAGCTGCCGTTTC -3'
(R):5'- TGTGAAATGCTGTATAACACTCGC -3'

Sequencing Primer
(F):5'- TTCTTGAAGGAGCACTGGAACTC -3'
(R):5'- TGTATAACACTCGCAGGCACTCAG -3'
Posted On2015-01-23