Incidental Mutation 'R2888:Olfr325'
ID260004
Institutional Source Beutler Lab
Gene Symbol Olfr325
Ensembl Gene ENSMUSG00000060765
Gene Nameolfactory receptor 325
SynonymsMOR275-5, MOR275-11_p, GA_x6K02T2NKPP-844642-843680
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58577730-58582365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58581162 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 106 (F106S)
Ref Sequence ENSEMBL: ENSMUSP00000145386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169428] [ENSMUST00000203418]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169428
AA Change: F106S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131257
Gene: ENSMUSG00000060765
AA Change: F106S

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 290 1.4e-6 PFAM
Pfam:7tm_1 45 294 1.6e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203418
AA Change: F106S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145386
Gene: ENSMUSG00000060765
AA Change: F106S

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 7.6e-14 PFAM
Pfam:7TM_GPCR_Srsx 36 130 1.1e-4 PFAM
Pfam:7tm_1 45 130 2.6e-16 PFAM
Meta Mutation Damage Score 0.7843 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Olfr325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr325 APN 11 58581810 missense probably benign
IGL01922:Olfr325 APN 11 58581073 missense probably benign 0.01
IGL02440:Olfr325 APN 11 58581209 missense probably damaging 1.00
IGL02456:Olfr325 APN 11 58581198 missense possibly damaging 0.48
IGL03088:Olfr325 APN 11 58581827 utr 3 prime probably benign
IGL03328:Olfr325 APN 11 58581713 missense probably damaging 1.00
R0604:Olfr325 UTSW 11 58581348 missense probably damaging 0.99
R1698:Olfr325 UTSW 11 58581251 missense probably damaging 1.00
R2473:Olfr325 UTSW 11 58581575 missense probably damaging 1.00
R4133:Olfr325 UTSW 11 58581075 missense probably damaging 0.97
R4710:Olfr325 UTSW 11 58581722 missense probably damaging 1.00
R4715:Olfr325 UTSW 11 58581429 missense probably damaging 1.00
R4898:Olfr325 UTSW 11 58581720 missense probably damaging 1.00
R4939:Olfr325 UTSW 11 58581211 missense probably damaging 1.00
R4977:Olfr325 UTSW 11 58581629 missense possibly damaging 0.57
R5389:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R5393:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R6137:Olfr325 UTSW 11 58581068 missense probably benign
R6302:Olfr325 UTSW 11 58581638 missense probably benign
R6655:Olfr325 UTSW 11 58581210 missense probably damaging 1.00
R6927:Olfr325 UTSW 11 58581665 missense possibly damaging 0.81
R7451:Olfr325 UTSW 11 58581690 missense probably damaging 1.00
R7494:Olfr325 UTSW 11 58581212 missense probably damaging 0.97
R7626:Olfr325 UTSW 11 58581173 missense probably damaging 0.97
R7724:Olfr325 UTSW 11 58581382 missense probably benign 0.01
R7874:Olfr325 UTSW 11 58581747 missense possibly damaging 0.93
R8217:Olfr325 UTSW 11 58580966 missense probably benign 0.00
R8252:Olfr325 UTSW 11 58581132 missense probably damaging 1.00
Z1177:Olfr325 UTSW 11 58581311 missense probably damaging 1.00
Z1186:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1186:Olfr325 UTSW 11 58580931 missense probably benign
Z1186:Olfr325 UTSW 11 58581002 missense probably benign
Z1186:Olfr325 UTSW 11 58581296 missense probably benign
Z1186:Olfr325 UTSW 11 58581657 missense probably benign
Z1187:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1187:Olfr325 UTSW 11 58580931 missense probably benign
Z1187:Olfr325 UTSW 11 58581002 missense probably benign
Z1187:Olfr325 UTSW 11 58581296 missense probably benign
Z1187:Olfr325 UTSW 11 58581657 missense probably benign
Z1188:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1188:Olfr325 UTSW 11 58580931 missense probably benign
Z1188:Olfr325 UTSW 11 58581002 missense probably benign
Z1188:Olfr325 UTSW 11 58581296 missense probably benign
Z1188:Olfr325 UTSW 11 58581657 missense probably benign
Z1189:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1189:Olfr325 UTSW 11 58580931 missense probably benign
Z1189:Olfr325 UTSW 11 58581296 missense probably benign
Z1189:Olfr325 UTSW 11 58581657 missense probably benign
Z1190:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1190:Olfr325 UTSW 11 58580931 missense probably benign
Z1190:Olfr325 UTSW 11 58581002 missense probably benign
Z1190:Olfr325 UTSW 11 58581296 missense probably benign
Z1190:Olfr325 UTSW 11 58581657 missense probably benign
Z1191:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1191:Olfr325 UTSW 11 58580931 missense probably benign
Z1191:Olfr325 UTSW 11 58581002 missense probably benign
Z1191:Olfr325 UTSW 11 58581296 missense probably benign
Z1191:Olfr325 UTSW 11 58581657 missense probably benign
Z1192:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1192:Olfr325 UTSW 11 58580931 missense probably benign
Z1192:Olfr325 UTSW 11 58581296 missense probably benign
Z1192:Olfr325 UTSW 11 58581657 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCCTGCTGGTACTCTCTGAC -3'
(R):5'- GAAGAAGTGATGGATCTCCCGG -3'

Sequencing Primer
(F):5'- GCTGGTACTCTCTGACACCCAC -3'
(R):5'- GATCTCCCGGGATCCACAGAATG -3'
Posted On2015-01-23