Mutagenetix > Incidental Mutation

Incidental Mutation 'R2888:Zfhx2'

260009

Institutional Source

Beutler Lab

Gene Symbol

Zfhx2

Ensembl Gene

ENSMUSG00000040721

Gene Name

zinc finger homeobox 2

Synonyms

zfh-5

MMRRC Submission

040476-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.292) question?

Stock #

R2888 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55060262-55092324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55064803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1908 (K1908R)

Ref Sequence

ENSEMBL: ENSMUSP00000045156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]

AlphaFold

Q2MHN3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036328
AA Change: K1908R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: K1908R

Domain	Start	End	E-Value	Type
low complexity region	22	42	N/A	INTRINSIC
ZnF_C2H2	230	252	1.43e1	SMART
low complexity region	333	345	N/A	INTRINSIC
low complexity region	428	439	N/A	INTRINSIC
ZnF_C2H2	446	469	8.94e-3	SMART
ZnF_U1	498	532	6.98e-1	SMART
ZnF_C2H2	501	525	3.21e-4	SMART
ZnF_U1	560	594	1.36e0	SMART
ZnF_C2H2	563	587	3.29e-1	SMART
low complexity region	597	623	N/A	INTRINSIC
ZnF_C2H2	752	776	6.4e0	SMART
ZnF_C2H2	815	839	2.02e-1	SMART
ZnF_U1	861	895	1.78e1	SMART
ZnF_C2H2	864	888	5.34e-1	SMART
ZnF_C2H2	974	997	1.51e1	SMART
ZnF_C2H2	1003	1026	1.51e0	SMART
low complexity region	1087	1103	N/A	INTRINSIC
low complexity region	1106	1126	N/A	INTRINSIC
ZnF_U1	1182	1216	3.42e0	SMART
ZnF_C2H2	1185	1209	8.22e-2	SMART
ZnF_U1	1239	1273	3.73e0	SMART
ZnF_C2H2	1242	1266	6.67e-2	SMART
low complexity region	1277	1304	N/A	INTRINSIC
low complexity region	1314	1326	N/A	INTRINSIC
low complexity region	1332	1346	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
low complexity region	1379	1400	N/A	INTRINSIC
low complexity region	1457	1465	N/A	INTRINSIC
ZnF_C2H2	1474	1497	5.34e0	SMART
low complexity region	1522	1531	N/A	INTRINSIC
low complexity region	1542	1554	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
HOX	1589	1651	1.97e-16	SMART
low complexity region	1656	1665	N/A	INTRINSIC
coiled coil region	1693	1723	N/A	INTRINSIC
ZnF_C2H2	1761	1783	2.53e-2	SMART
low complexity region	1837	1847	N/A	INTRINSIC
HOX	1851	1913	2.34e-18	SMART
low complexity region	1984	1995	N/A	INTRINSIC
low complexity region	2001	2051	N/A	INTRINSIC
HOX	2058	2120	1.52e-17	SMART
ZnF_U1	2136	2170	1.09e1	SMART
ZnF_C2H2	2139	2163	5.4e1	SMART
low complexity region	2328	2354	N/A	INTRINSIC
low complexity region	2385	2426	N/A	INTRINSIC
ZnF_U1	2482	2516	8.31e-1	SMART
ZnF_C2H2	2485	2509	9.46e0	SMART
low complexity region	2523	2538	N/A	INTRINSIC
low complexity region	2553	2562	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176665

SMART Domains

Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

Domain	Start	End	E-Value	Type
ZnF_C2H2	13	37	5.34e-1	SMART
ZnF_C2H2	133	156	1.51e1	SMART
ZnF_C2H2	162	185	1.51e0	SMART
low complexity region	246	262	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
ZnF_C2H2	344	368	8.22e-2	SMART
ZnF_C2H2	401	425	6.67e-2	SMART
low complexity region	436	463	N/A	INTRINSIC
low complexity region	473	485	N/A	INTRINSIC
low complexity region	491	505	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
low complexity region	538	559	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183750

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183822

SMART Domains

Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

Domain	Start	End	E-Value	Type
PDB:2JMU\|A	5	64	3e-23	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185121

Meta Mutation Damage Score

0.1435

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	A	T	X: 78,370,682	I338F	probably damaging	Het
Acd	A	G	8: 105,698,838	S288P	probably benign	Het
Aimp2	T	C	5: 143,909,735		probably benign	Het
Atp8b2	T	C	3: 89,958,293	D100G	probably damaging	Het
Cacna1i	A	T	15: 80,374,767	I1226F	probably damaging	Het
Dsp	C	A	13: 38,192,248	N1336K	possibly damaging	Het
Extl2	T	C	3: 116,027,257	F251S	probably damaging	Het
Gm13089	G	T	4: 143,696,890	T443K	probably benign	Het
Gusb	T	C	5: 130,000,502	H146R	probably damaging	Het
Itpr2	C	T	6: 146,171,293	G2380S	probably damaging	Het
Kansl1l	T	C	1: 66,724,605	K762E	probably benign	Het
Krtap4-9	C	A	11: 99,785,419	C55*	probably null	Het
Lamp1	T	A	8: 13,173,891	L341H	probably damaging	Het
Llcfc1	A	T	6: 41,684,603	K29M	probably damaging	Het
Malrd1	A	T	2: 16,074,757	I1762F	unknown	Het
Muc5b	G	A	7: 141,861,554	V2746M	probably damaging	Het
Mug1	T	A	6: 121,881,843	D1173E	probably benign	Het
Myo5b	G	C	18: 74,762,618	E1782Q	probably damaging	Het
Olfr325	T	C	11: 58,581,162	F106S	possibly damaging	Het
Pcdha5	A	G	18: 36,961,887	D483G	probably damaging	Het
Phex	T	C	X: 157,310,958	I439V	probably benign	Het
Pkd1l1	T	A	11: 8,947,251	S103C	probably damaging	Het
Plekha4	C	T	7: 45,538,244	R176C	probably damaging	Het
Ppp1r3a	T	G	6: 14,718,249	S889R	possibly damaging	Het
Prol1	C	A	5: 88,328,309	A186E	unknown	Het
Rbm39	C	T	2: 156,167,583	R123H	probably benign	Het
Rtn4	T	C	11: 29,693,687	S167P	probably damaging	Het
Slc35a5	A	G	16: 45,151,560	C114R	probably damaging	Het
Smoc2	T	C	17: 14,397,625		probably null	Het
Sptbn2	A	G	19: 4,748,636	T1998A	possibly damaging	Het
Tbc1d5	T	A	17: 50,935,549	E173D	probably damaging	Het
Tsc2	A	G	17: 24,631,995		probably null	Het
Umps	A	T	16: 33,963,870	V71E	probably damaging	Het
Vmn2r13	T	C	5: 109,191,974	D45G	possibly damaging	Het
Wdfy4	C	A	14: 33,109,519	E917*	probably null	Het
Zfp511	A	C	7: 140,039,382	D204A	probably benign	Het

Other mutations in Zfhx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Zfhx2	APN	14	55066565	missense	possibly damaging	0.93
IGL00164:Zfhx2	APN	14	55065026	missense	possibly damaging	0.73
IGL00235:Zfhx2	APN	14	55063257	missense	probably benign	0.11
IGL00925:Zfhx2	APN	14	55073061	missense	probably benign	0.06
IGL01025:Zfhx2	APN	14	55064260	missense	probably damaging	1.00
IGL01061:Zfhx2	APN	14	55073882	missense	possibly damaging	0.96
IGL01486:Zfhx2	APN	14	55067090	missense	probably damaging	1.00
IGL01875:Zfhx2	APN	14	55063915	missense	unknown
IGL01990:Zfhx2	APN	14	55073590	missense	probably damaging	0.99
IGL02097:Zfhx2	APN	14	55062894	missense	probably damaging	1.00
IGL02269:Zfhx2	APN	14	55071936	missense	probably benign	0.00
IGL02488:Zfhx2	APN	14	55065103	missense	possibly damaging	0.72
IGL02624:Zfhx2	APN	14	55066628	missense	probably benign	0.06
IGL03087:Zfhx2	APN	14	55072845	missense	possibly damaging	0.85
G1patch:Zfhx2	UTSW	14	55064082	nonsense	probably null
PIT4403001:Zfhx2	UTSW	14	55074980	missense	probably benign
R0148:Zfhx2	UTSW	14	55072897	missense	possibly damaging	0.86
R0323:Zfhx2	UTSW	14	55065979	missense	possibly damaging	0.73
R0328:Zfhx2	UTSW	14	55071988	missense	probably benign
R0348:Zfhx2	UTSW	14	55063508	missense	probably damaging	0.99
R0442:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R0533:Zfhx2	UTSW	14	55064090	missense	probably benign	0.23
R0561:Zfhx2	UTSW	14	55065889	missense	probably benign	0.01
R0627:Zfhx2	UTSW	14	55065327	missense	probably benign
R0659:Zfhx2	UTSW	14	55073801	missense	possibly damaging	0.73
R0675:Zfhx2	UTSW	14	55063163	missense	probably damaging	0.99
R1301:Zfhx2	UTSW	14	55063397	missense	probably benign	0.32
R1563:Zfhx2	UTSW	14	55065088	missense	probably benign	0.33
R1607:Zfhx2	UTSW	14	55062985	missense	probably damaging	1.00
R1694:Zfhx2	UTSW	14	55073944	missense	possibly damaging	0.91
R1710:Zfhx2	UTSW	14	55065998	missense	possibly damaging	0.70
R1773:Zfhx2	UTSW	14	55072891	missense	possibly damaging	0.53
R1879:Zfhx2	UTSW	14	55065617	missense	probably benign	0.32
R1879:Zfhx2	UTSW	14	55072749	missense	possibly damaging	0.96
R1933:Zfhx2	UTSW	14	55075238	start gained	probably benign
R1944:Zfhx2	UTSW	14	55074732	missense	probably benign	0.18
R2889:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2915:Zfhx2	UTSW	14	55064557	missense	probably damaging	0.98
R3971:Zfhx2	UTSW	14	55074475	missense	probably benign	0.33
R4082:Zfhx2	UTSW	14	55065205	missense	probably benign
R4134:Zfhx2	UTSW	14	55065143	missense	possibly damaging	0.93
R4231:Zfhx2	UTSW	14	55073534	missense	possibly damaging	0.73
R4675:Zfhx2	UTSW	14	55067221	missense	probably benign	0.03
R4764:Zfhx2	UTSW	14	55066915	missense	possibly damaging	0.96
R4866:Zfhx2	UTSW	14	55065536	missense	possibly damaging	0.73
R4940:Zfhx2	UTSW	14	55066434	missense	possibly damaging	0.53
R5125:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5178:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5554:Zfhx2	UTSW	14	55064317	missense	probably damaging	1.00
R5689:Zfhx2	UTSW	14	55073903	missense	possibly damaging	0.53
R5768:Zfhx2	UTSW	14	55074365	missense	probably benign
R5792:Zfhx2	UTSW	14	55066846	missense	possibly damaging	0.72
R5834:Zfhx2	UTSW	14	55073330	nonsense	probably null
R5895:Zfhx2	UTSW	14	55065891	missense	probably benign
R5999:Zfhx2	UTSW	14	55074005	missense	probably benign
R6025:Zfhx2	UTSW	14	55065208	missense	probably benign	0.00
R6106:Zfhx2	UTSW	14	55068310	critical splice acceptor site	probably null
R6135:Zfhx2	UTSW	14	55074196	missense	possibly damaging	0.85
R6186:Zfhx2	UTSW	14	55063160	missense	probably damaging	0.99
R6379:Zfhx2	UTSW	14	55074338	missense	probably benign
R6725:Zfhx2	UTSW	14	55064082	nonsense	probably null
R7089:Zfhx2	UTSW	14	55065772	missense	probably benign	0.33
R7383:Zfhx2	UTSW	14	55068253	missense	probably benign	0.00
R7470:Zfhx2	UTSW	14	55066750	missense	possibly damaging	0.52
R7606:Zfhx2	UTSW	14	55066663	missense	probably benign	0.12
R7607:Zfhx2	UTSW	14	55066231	missense	possibly damaging	0.86
R7698:Zfhx2	UTSW	14	55062849	missense	probably benign	0.00
R7730:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R8142:Zfhx2	UTSW	14	55073438	missense	possibly damaging	0.86
R8188:Zfhx2	UTSW	14	55064441	missense	probably benign	0.18
R8212:Zfhx2	UTSW	14	55072916	missense	possibly damaging	0.70
R8264:Zfhx2	UTSW	14	55065512	missense	possibly damaging	0.53
R8331:Zfhx2	UTSW	14	55071987	missense	probably benign	0.00
R8369:Zfhx2	UTSW	14	55066744	missense	probably benign	0.05
R8371:Zfhx2	UTSW	14	55064092	missense	probably damaging	0.99
R8383:Zfhx2	UTSW	14	55074071	missense	possibly damaging	0.73
R8415:Zfhx2	UTSW	14	55070622	missense	probably benign
R8441:Zfhx2	UTSW	14	55066528	missense	possibly damaging	0.96
R8466:Zfhx2	UTSW	14	55072896	missense	possibly damaging	0.53
R8504:Zfhx2	UTSW	14	55065786	missense	probably benign	0.00
R8708:Zfhx2	UTSW	14	55075052	missense	probably benign
R8804:Zfhx2	UTSW	14	55074734	missense	probably benign	0.18
R8913:Zfhx2	UTSW	14	55072086	missense	probably benign	0.02
R8952:Zfhx2	UTSW	14	55072750	missense	possibly damaging	0.86
R9057:Zfhx2	UTSW	14	55072570	missense	possibly damaging	0.53
R9060:Zfhx2	UTSW	14	55074346	missense	probably benign	0.00
R9197:Zfhx2	UTSW	14	55074722	nonsense	probably null
R9622:Zfhx2	UTSW	14	55066026	missense	probably benign	0.18
R9623:Zfhx2	UTSW	14	55064734	missense	probably damaging	0.98
R9775:Zfhx2	UTSW	14	55067105	missense	probably benign	0.01
R9780:Zfhx2	UTSW	14	55075037	missense	probably benign	0.02
X0065:Zfhx2	UTSW	14	55066960	missense	probably benign	0.33
Z1088:Zfhx2	UTSW	14	55074180	missense	possibly damaging	0.73
Z1177:Zfhx2	UTSW	14	55065920	missense	probably benign	0.40
Z1177:Zfhx2	UTSW	14	55066982	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CTTTCCCAGGTGGTAGGAATG -3'
(R):5'- AGCGGAACCCAGTAGTATCG -3'

Sequencing Primer
(F):5'- CCAACAGCAGGGGTGACTG -3'
(R):5'- GAACCCAGTAGTATCGGGCAC -3'

Posted On

2015-01-23