Incidental Mutation 'R2888:Umps'
ID260011
Institutional Source Beutler Lab
Gene Symbol Umps
Ensembl Gene ENSMUSG00000022814
Gene Nameuridine monophosphate synthetase
Synonyms1700095D23Rik
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33954782-33967038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33963870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 71 (V71E)
Ref Sequence ENSEMBL: ENSMUSP00000023510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023510] [ENSMUST00000131990]
Predicted Effect probably damaging
Transcript: ENSMUST00000023510
AA Change: V71E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023510
Gene: ENSMUSG00000022814
AA Change: V71E

DomainStartEndE-ValueType
Pfam:Pribosyltran 40 166 3.3e-14 PFAM
Blast:OMPdecase 190 237 1e-12 BLAST
OMPdecase 253 466 4.17e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131990
SMART Domains Protein: ENSMUSP00000119423
Gene: ENSMUSG00000022814

DomainStartEndE-ValueType
SCOP:d1lh0a_ 6 53 2e-5 SMART
PDB:2WNS|B 7 57 6e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145415
Meta Mutation Damage Score 0.9544 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine 5'-monophosphate synthase. The encoded protein is a bifunctional enzyme that catalyzes the final two steps of the de novo pyrimidine biosynthetic pathway. The first reaction is carried out by the N-terminal enzyme orotate phosphoribosyltransferase which converts orotic acid to orotidine-5'-monophosphate. The terminal reaction is carried out by the C-terminal enzyme OMP decarboxylase which converts orotidine-5'-monophosphate to uridine monophosphate. Defects in this gene are the cause of hereditary orotic aciduria. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Umps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Umps APN 16 33966902 missense probably damaging 1.00
IGL02833:Umps APN 16 33962153 nonsense probably null
R0584:Umps UTSW 16 33959124 missense probably damaging 1.00
R4125:Umps UTSW 16 33956918 nonsense probably null
R4428:Umps UTSW 16 33961586 missense probably damaging 1.00
R5261:Umps UTSW 16 33966974 missense probably benign 0.00
R6030:Umps UTSW 16 33962138 missense probably benign
R6030:Umps UTSW 16 33962138 missense probably benign
R7066:Umps UTSW 16 33961733 nonsense probably null
R8303:Umps UTSW 16 33963870 missense possibly damaging 0.88
Z1088:Umps UTSW 16 33966825 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGGCCTGATAGAGAAC -3'
(R):5'- GTGCTTAGGAGGCATAGATACTC -3'

Sequencing Primer
(F):5'- TAGAGAACAAAATCCTAGCAGGTTAC -3'
(R):5'- GAGGCATAGATACTCATGGTAAATTG -3'
Posted On2015-01-23