Incidental Mutation 'R2888:Slc35a5'
ID260012
Institutional Source Beutler Lab
Gene Symbol Slc35a5
Ensembl Gene ENSMUSG00000022664
Gene Namesolute carrier family 35, member A5
Synonyms1010001J06Rik, D730043G07Rik, D16Ertd450e
MMRRC Submission 040476-MU
Accession Numbers

Genbank: NM_028756; MGI: 1921352

Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45139573-45158706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45151560 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 114 (C114R)
Ref Sequence ENSEMBL: ENSMUSP00000110247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023344] [ENSMUST00000114600] [ENSMUST00000180636] [ENSMUST00000181177] [ENSMUST00000181750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023344
AA Change: C98R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023344
Gene: ENSMUSG00000022664
AA Change: C98R

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 28 387 1.3e-54 PFAM
low complexity region 424 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114600
AA Change: C114R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110247
Gene: ENSMUSG00000022664
AA Change: C114R

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Nuc_sug_transp 107 155 1.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152364
Predicted Effect probably damaging
Transcript: ENSMUST00000180636
AA Change: C98R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137821
Gene: ENSMUSG00000022664
AA Change: C98R

DomainStartEndE-ValueType
Pfam:UAA 30 196 5.2e-8 PFAM
Pfam:TPT 31 177 3.3e-7 PFAM
Pfam:EamA 73 179 1.2e-7 PFAM
Pfam:Nuc_sug_transp 91 222 7.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181177
SMART Domains Protein: ENSMUSP00000137789
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 30 94 1.1e-12 PFAM
low complexity region 139 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181437
Predicted Effect probably benign
Transcript: ENSMUST00000181750
SMART Domains Protein: ENSMUSP00000137937
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
transmembrane domain 15 36 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which belongs to subfamily 35A of the solute carrier superfamily. The encoded protein is a nucleoside-sugar transporter. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI

 All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Slc35a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc35a5 APN 16 45152608 nonsense probably null
IGL01012:Slc35a5 APN 16 45143832 missense probably damaging 1.00
IGL01396:Slc35a5 APN 16 45151503 missense probably damaging 1.00
IGL03293:Slc35a5 APN 16 45143781 missense probably damaging 1.00
3-1:Slc35a5 UTSW 16 45143892 missense probably damaging 0.99
R1532:Slc35a5 UTSW 16 45151557 missense probably benign 0.03
R1561:Slc35a5 UTSW 16 45151521 missense possibly damaging 0.93
R1864:Slc35a5 UTSW 16 45143708 missense possibly damaging 0.66
R2086:Slc35a5 UTSW 16 45144265 missense probably damaging 0.99
R2887:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2889:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2890:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R3080:Slc35a5 UTSW 16 45144395 missense probably benign 0.06
R3434:Slc35a5 UTSW 16 45144033 missense probably benign 0.23
R3720:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3722:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3916:Slc35a5 UTSW 16 45158158 intron probably benign
R3917:Slc35a5 UTSW 16 45158158 intron probably benign
R4616:Slc35a5 UTSW 16 45144292 missense probably benign 0.12
R6648:Slc35a5 UTSW 16 45143917 missense probably damaging 1.00
R6881:Slc35a5 UTSW 16 45144080 missense possibly damaging 0.83
R7730:Slc35a5 UTSW 16 45143883 missense probably damaging 0.97
R7832:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
R8113:Slc35a5 UTSW 16 45142188 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAAGTCAGTATTCAGGTGGC -3'
(R):5'- CAGAGGCAATTTAATAAAGCCCAG -3'

Sequencing Primer
(F):5'- CAAGTCAGTATTCAGGTGGCTCTAG -3'
(R):5'- GCAATTTAATAAAGCCCAGCTAATAG -3'
Posted On2015-01-23