Incidental Mutation 'R2888:Smoc2'
ID260013
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene NameSPARC related modular calcium binding 2
SynonymsSmoc2l, 5430426J21Rik, 1700056C05Rik
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14279506-14404790 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 14397625 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
Predicted Effect probably null
Transcript: ENSMUST00000024660
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Atp8b2 T C 3: 89,958,293 D100G probably damaging Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14325614 missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14347233 missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14375527 splice site probably benign
IGL02975:Smoc2 APN 17 14336610 missense probably damaging 0.98
FR4976:Smoc2 UTSW 17 14401562 small deletion probably benign
R2291:Smoc2 UTSW 17 14368971 missense possibly damaging 0.53
R2343:Smoc2 UTSW 17 14344342 missense probably benign 0.22
R3878:Smoc2 UTSW 17 14325617 missense probably damaging 1.00
R4872:Smoc2 UTSW 17 14369033 missense probably benign 0.12
R5153:Smoc2 UTSW 17 14336579 missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14375457 missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14368965 missense probably benign 0.19
R5292:Smoc2 UTSW 17 14336573 missense probably damaging 0.98
R5794:Smoc2 UTSW 17 14369048 missense possibly damaging 0.94
R7810:Smoc2 UTSW 17 14325622 missense probably damaging 1.00
R7996:Smoc2 UTSW 17 14375468 nonsense probably null
R8811:Smoc2 UTSW 17 14325634 missense probably damaging 1.00
X0026:Smoc2 UTSW 17 14336633 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TACGAATACAGTGCGCCTGC -3'
(R):5'- ATGAAGAGGGAGGCTGTTCC -3'

Sequencing Primer
(F):5'- CATCTCATTCACATTGAAGCAAGTC -3'
(R):5'- ATGGTCCGCCTCCTCTAAGG -3'
Posted On2015-01-23