Incidental Mutation 'R2889:Zfp189'
ID260026
Institutional Source Beutler Lab
Gene Symbol Zfp189
Ensembl Gene ENSMUSG00000039634
Gene Namezinc finger protein 189
SynonymsC430015I23Rik
MMRRC Submission 040477-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2889 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49521176-49531517 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 49521547 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042964] [ENSMUST00000057829] [ENSMUST00000107696]
Predicted Effect probably benign
Transcript: ENSMUST00000042964
SMART Domains Protein: ENSMUSP00000036663
Gene: ENSMUSG00000039634

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057829
SMART Domains Protein: ENSMUSP00000062476
Gene: ENSMUSG00000044018

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:Ribosomal_L50 61 156 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107696
SMART Domains Protein: ENSMUSP00000103324
Gene: ENSMUSG00000039634

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kruppel-like zinc finger proteins such as ZNF189 contain a conserved stretch of 7 amino acids that connects a variable number of DNA-binding zinc finger repeats of the cys(2)his(2) (C2H2) type (summarized by Odeberg et al., 1998 [PubMed 9653648]). Approximately 30% of human Kruppel-like zinc finger proteins contain an N-terminal Kruppel-associated box (KRAB) domain. The KRAB domain consists of approximately 75 amino acids that may be subdivided into an A box, which is present in every KRAB domain and is essential for transcriptional repression, and a B box, which is not always present.[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Adam28 A T 14: 68,634,845 M316K possibly damaging Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
AI314180 T C 4: 58,836,165 K725R probably benign Het
Ankrd6 C A 4: 32,818,704 L207F probably damaging Het
Aurka A G 2: 172,367,120 S54P probably benign Het
Kcnq5 T A 1: 21,402,302 D879V probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Msantd3 T C 4: 48,552,494 Y28H possibly damaging Het
Npr2 T C 4: 43,641,600 I468T probably benign Het
Olfr1336 T A 7: 6,460,941 V144D probably damaging Het
Olfr477 A T 7: 107,990,577 I71F probably benign Het
Pcdhb9 G T 18: 37,403,223 V757F probably benign Het
Pclo C A 5: 14,856,981 H5000N unknown Het
Phex T C X: 157,310,958 I439V probably benign Het
Pmfbp1 T C 8: 109,525,431 Y403H probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Rsrc2 A T 5: 123,736,557 probably benign Het
Ryr1 T C 7: 29,078,741 D2110G possibly damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Son T C 16: 91,659,899 probably benign Het
Spef2 G A 15: 9,630,613 T1067I probably damaging Het
Vmn2r103 T C 17: 19,793,600 L218P probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfy1 G A Y: 726,307 T486I possibly damaging Het
Other mutations in Zfp189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02075:Zfp189 APN 4 49522445 missense probably damaging 0.98
R1754:Zfp189 UTSW 4 49529342 missense possibly damaging 0.87
R1848:Zfp189 UTSW 4 49529266 missense probably benign 0.01
R1868:Zfp189 UTSW 4 49529283 missense possibly damaging 0.90
R1903:Zfp189 UTSW 4 49529511 nonsense probably null
R2247:Zfp189 UTSW 4 49530393 missense possibly damaging 0.95
R4389:Zfp189 UTSW 4 49529934 missense probably damaging 1.00
R4659:Zfp189 UTSW 4 49530342 missense probably benign 0.33
R4704:Zfp189 UTSW 4 49530081 missense probably damaging 0.98
R4840:Zfp189 UTSW 4 49529984 missense probably damaging 1.00
R4920:Zfp189 UTSW 4 49529302 missense probably damaging 0.98
R5011:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5013:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5522:Zfp189 UTSW 4 49529739 nonsense probably null
R5639:Zfp189 UTSW 4 49530153 missense probably benign 0.01
R6814:Zfp189 UTSW 4 49529026 missense probably damaging 0.99
R7372:Zfp189 UTSW 4 49530417 missense possibly damaging 0.95
R7491:Zfp189 UTSW 4 49521569 missense probably benign 0.06
R7680:Zfp189 UTSW 4 49521547 start gained probably benign
R7800:Zfp189 UTSW 4 49529367 missense possibly damaging 0.95
R8023:Zfp189 UTSW 4 49530312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGACTTTGAGGCGGAG -3'
(R):5'- TACACAGGAGTTGACTGGGGTC -3'

Sequencing Primer
(F):5'- GGAGACCCTAAGGCTAGGC -3'
(R):5'- CCTTTCTTAAGAGTTGTAGAAATGGC -3'
Posted On2015-01-23