Incidental Mutation 'R2889:Vmn2r103'
ID260044
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
MMRRC Submission 040477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2889 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19793600 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 218 (L218P)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: L218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: L218P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Adam28 A T 14: 68,634,845 M316K possibly damaging Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
AI314180 T C 4: 58,836,165 K725R probably benign Het
Ankrd6 C A 4: 32,818,704 L207F probably damaging Het
Aurka A G 2: 172,367,120 S54P probably benign Het
Kcnq5 T A 1: 21,402,302 D879V probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Msantd3 T C 4: 48,552,494 Y28H possibly damaging Het
Npr2 T C 4: 43,641,600 I468T probably benign Het
Olfr1336 T A 7: 6,460,941 V144D probably damaging Het
Olfr477 A T 7: 107,990,577 I71F probably benign Het
Pcdhb9 G T 18: 37,403,223 V757F probably benign Het
Pclo C A 5: 14,856,981 H5000N unknown Het
Phex T C X: 157,310,958 I439V probably benign Het
Pmfbp1 T C 8: 109,525,431 Y403H probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Rsrc2 A T 5: 123,736,557 probably benign Het
Ryr1 T C 7: 29,078,741 D2110G possibly damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Son T C 16: 91,659,899 probably benign Het
Spef2 G A 15: 9,630,613 T1067I probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Zfy1 G A Y: 726,307 T486I possibly damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R7968:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 19793497 missense probably benign 0.00
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGTAATCCAGTAAGTCCTTGAGAC -3'
(R):5'- ACCTTCTAGGGAATCAACATCTC -3'

Sequencing Primer
(F):5'- ATATCCCATTAAAATGTTCTCCTGTC -3'
(R):5'- TCTAGGGAATCAACATCTCCATAAAC -3'
Posted On2015-01-23