Incidental Mutation 'R2890:Olfr1287'
ID260053
Institutional Source Beutler Lab
Gene Symbol Olfr1287
Ensembl Gene ENSMUSG00000095586
Gene Nameolfactory receptor 1287
SynonymsMOR248-15, GA_x6K02T2Q125-72500603-72501520
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111449142-111450059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111449289 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 50 (I50F)
Ref Sequence ENSEMBL: ENSMUSP00000074850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075390]
Predicted Effect probably benign
Transcript: ENSMUST00000075390
AA Change: I50F

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074850
Gene: ENSMUSG00000095586
AA Change: I50F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.7e-48 PFAM
Pfam:7tm_1 41 287 9.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Olfr1287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr1287 APN 2 111449889 missense probably benign 0.13
IGL01748:Olfr1287 APN 2 111449530 missense probably damaging 1.00
IGL02264:Olfr1287 APN 2 111449862 missense probably benign 0.05
IGL02371:Olfr1287 APN 2 111450009 missense probably damaging 1.00
IGL02385:Olfr1287 APN 2 111449350 missense probably damaging 1.00
IGL02704:Olfr1287 APN 2 111449147 missense probably benign 0.00
R0368:Olfr1287 UTSW 2 111449788 missense probably benign 0.07
R1520:Olfr1287 UTSW 2 111449274 missense probably benign 0.00
R2036:Olfr1287 UTSW 2 111449626 missense possibly damaging 0.80
R3757:Olfr1287 UTSW 2 111449257 missense possibly damaging 0.95
R3801:Olfr1287 UTSW 2 111449565 missense probably benign 0.07
R3958:Olfr1287 UTSW 2 111449885 missense possibly damaging 0.50
R4077:Olfr1287 UTSW 2 111449503 missense probably damaging 0.99
R4763:Olfr1287 UTSW 2 111449678 nonsense probably null
R4955:Olfr1287 UTSW 2 111449605 missense probably damaging 1.00
R4975:Olfr1287 UTSW 2 111449683 missense probably benign 0.16
R5046:Olfr1287 UTSW 2 111449589 missense probably benign 0.01
R5512:Olfr1287 UTSW 2 111449754 missense probably benign 0.00
R5708:Olfr1287 UTSW 2 111450009 missense probably damaging 1.00
R5771:Olfr1287 UTSW 2 111450061 unclassified probably null
R5780:Olfr1287 UTSW 2 111449833 missense probably benign 0.03
R6981:Olfr1287 UTSW 2 111449352 missense probably benign 0.00
R7073:Olfr1287 UTSW 2 111449286 missense probably benign 0.22
R7633:Olfr1287 UTSW 2 111449622 missense probably benign
R8121:Olfr1287 UTSW 2 111449160 missense probably benign 0.20
RF037:Olfr1287 UTSW 2 111449551 missense not run
RF039:Olfr1287 UTSW 2 111449551 missense not run
Z1088:Olfr1287 UTSW 2 111449457 missense probably benign 0.02
Z1176:Olfr1287 UTSW 2 111449784 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCAACTCATTAGAACACCTTGTAG -3'
(R):5'- CACATACCGGTCATAGGCC -3'

Sequencing Primer
(F):5'- ACACCTTGTAGTAAATGGAAGAAAC -3'
(R):5'- CCGGTCATAGGCCATTGTTACAAG -3'
Posted On2015-01-23