Incidental Mutation 'R2890:Chrm5'
ID260054
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Namecholinergic receptor, muscarinic 5
SynonymsM5R, muscarinic acetylcholine receptor 5
MMRRC Submission 040478-MU
Accession Numbers

Genbank: NM_205783; MGI: 109248

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112479171-112480769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112479703 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
Predicted Effect probably benign
Transcript: ENSMUST00000099589
AA Change: Y356C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: Y356C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112479232 missense probably benign
IGL01611:Chrm5 APN 2 112480306 nonsense probably null
IGL02152:Chrm5 APN 2 112480568 missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112480361 missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112480211 missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112480720 missense probably benign
R0432:Chrm5 UTSW 2 112479655 missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112479869 missense probably benign 0.00
R1611:Chrm5 UTSW 2 112479187 missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112479837 missense probably benign 0.00
R1693:Chrm5 UTSW 2 112479280 missense probably damaging 1.00
R1988:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112479227 missense probably null 0.93
R4659:Chrm5 UTSW 2 112479757 missense probably benign
R4785:Chrm5 UTSW 2 112479585 missense probably benign 0.25
R5196:Chrm5 UTSW 2 112480384 missense probably damaging 1.00
R5734:Chrm5 UTSW 2 112480100 missense probably benign 0.28
R6343:Chrm5 UTSW 2 112479448 missense probably damaging 1.00
R6499:Chrm5 UTSW 2 112480480 missense probably benign
R6672:Chrm5 UTSW 2 112479796 missense probably benign
R6905:Chrm5 UTSW 2 112479556 missense probably benign 0.00
R7192:Chrm5 UTSW 2 112480327 missense probably damaging 0.97
R7775:Chrm5 UTSW 2 112479956 missense probably benign 0.07
R7778:Chrm5 UTSW 2 112479956 missense probably benign 0.07
X0023:Chrm5 UTSW 2 112480481 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTGGACACTGGGAAGGAAC -3'
(R):5'- TCATCCTCCCGTAGAAGCAC -3'

Sequencing Primer
(F):5'- GAACAGGGCATGATTTTCACC -3'
(R):5'- CCACTGATCTAAGTGCTGACTGG -3'
Posted On2015-01-23