Incidental Mutation 'R2890:Zfp619'
ID260059
Institutional Source Beutler Lab
Gene Symbol Zfp619
Ensembl Gene ENSMUSG00000068959
Gene Namezinc finger protein 619
Synonyms3000002G13Rik
MMRRC Submission 040478-MU
Accession Numbers

Genbank: NM_001004139; MGI: 1917477

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location39517766-39540420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39534969 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 141 (T141K)
Ref Sequence ENSEMBL: ENSMUSP00000103650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108015]
Predicted Effect probably benign
Transcript: ENSMUST00000108015
AA Change: T141K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103650
Gene: ENSMUSG00000068959
AA Change: T141K

DomainStartEndE-ValueType
KRAB 4 61 2.19e-20 SMART
ZnF_C2H2 218 240 2.91e-2 SMART
ZnF_C2H2 246 268 5.81e-2 SMART
ZnF_C2H2 274 296 3.16e-3 SMART
ZnF_C2H2 302 324 2.4e-3 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 380 6.32e-3 SMART
ZnF_C2H2 386 408 8.47e-4 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 1.58e-3 SMART
ZnF_C2H2 470 492 5.42e-2 SMART
ZnF_C2H2 526 548 2.09e-3 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
ZnF_C2H2 582 604 1.56e-2 SMART
ZnF_C2H2 610 632 2.24e-3 SMART
ZnF_C2H2 638 660 4.72e-2 SMART
ZnF_C2H2 666 688 7.78e-3 SMART
ZnF_C2H2 694 716 5.9e-3 SMART
ZnF_C2H2 722 744 1.12e-3 SMART
ZnF_C2H2 748 770 6.42e-4 SMART
ZnF_C2H2 776 798 1.38e-3 SMART
ZnF_C2H2 804 826 9.44e-2 SMART
ZnF_C2H2 832 854 2.36e-2 SMART
ZnF_C2H2 860 882 8.94e-3 SMART
ZnF_C2H2 888 910 3.58e-2 SMART
ZnF_C2H2 916 938 6.42e-4 SMART
ZnF_C2H2 942 964 4.72e-2 SMART
ZnF_C2H2 970 992 2.3e-5 SMART
ZnF_C2H2 998 1020 8.34e-3 SMART
ZnF_C2H2 1026 1048 8.81e-2 SMART
ZnF_C2H2 1054 1076 1.69e-3 SMART
ZnF_C2H2 1082 1104 6.32e-3 SMART
ZnF_C2H2 1110 1132 1.47e-3 SMART
ZnF_C2H2 1138 1160 7.15e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), such as ZNF208, bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. A conserved protein motif, termed the Kruppel-associated box (KRAB) domain, mediates protein-protein interactions (Eichler et al., 1998 [PubMed 9724325]). See ZNF91 (MIM 603971) for further information on ZNFs.[supplied by OMIM, Aug 2009]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Other mutations in Zfp619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zfp619 APN 7 39534864 missense probably damaging 1.00
IGL02221:Zfp619 APN 7 39536910 missense probably benign 0.00
IGL02625:Zfp619 APN 7 39534185 splice site probably benign
3-1:Zfp619 UTSW 7 39536765 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0113:Zfp619 UTSW 7 39537759 missense probably benign 0.01
R0377:Zfp619 UTSW 7 39536797 nonsense probably null
R0614:Zfp619 UTSW 7 39537675 missense possibly damaging 0.79
R0848:Zfp619 UTSW 7 39536559 missense probably damaging 1.00
R1157:Zfp619 UTSW 7 39536858 missense probably damaging 0.98
R2047:Zfp619 UTSW 7 39537638 missense probably damaging 0.99
R2074:Zfp619 UTSW 7 39534761 missense probably benign 0.00
R2419:Zfp619 UTSW 7 39535883 missense possibly damaging 0.71
R2571:Zfp619 UTSW 7 39537171 missense probably damaging 1.00
R3814:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4003:Zfp619 UTSW 7 39537306 missense possibly damaging 0.91
R4059:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4503:Zfp619 UTSW 7 39536856 missense probably damaging 1.00
R4664:Zfp619 UTSW 7 39534135 missense probably benign 0.00
R4696:Zfp619 UTSW 7 39536988 missense probably benign 0.00
R4895:Zfp619 UTSW 7 39537972 missense possibly damaging 0.68
R4975:Zfp619 UTSW 7 39537080 missense possibly damaging 0.90
R4977:Zfp619 UTSW 7 39537387 missense probably damaging 1.00
R5049:Zfp619 UTSW 7 39535514 missense probably benign 0.02
R5240:Zfp619 UTSW 7 39537218 missense possibly damaging 0.68
R5468:Zfp619 UTSW 7 39535728 missense unknown
R5546:Zfp619 UTSW 7 39535153 missense probably benign 0.01
R5572:Zfp619 UTSW 7 39535239 missense probably benign 0.01
R6106:Zfp619 UTSW 7 39535134 missense probably benign 0.01
R6329:Zfp619 UTSW 7 39537545 missense probably damaging 1.00
R6354:Zfp619 UTSW 7 39534819 missense probably benign 0.02
R6395:Zfp619 UTSW 7 39537030 missense possibly damaging 0.91
R6490:Zfp619 UTSW 7 39534162 missense probably benign 0.00
R6560:Zfp619 UTSW 7 39537530 missense probably damaging 1.00
R6713:Zfp619 UTSW 7 39537898 missense probably damaging 0.99
R7011:Zfp619 UTSW 7 39537762 missense probably damaging 1.00
R7022:Zfp619 UTSW 7 39534963 missense probably benign 0.00
R7046:Zfp619 UTSW 7 39537363 missense possibly damaging 0.95
R7206:Zfp619 UTSW 7 39535400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCGTCAAATGCTAGGTT -3'
(R):5'- CTTTCCTGTCTCTGAAGGGAAC -3'

Sequencing Primer
(F):5'- CTGCTCAAGTGGAACTATGTGAC -3'
(R):5'- TCTCTGAAGGGAACTGTGACATC -3'
Posted On2015-01-23