Incidental Mutation 'R2890:Amdhd1'
ID260067
Institutional Source Beutler Lab
Gene Symbol Amdhd1
Ensembl Gene ENSMUSG00000015890
Gene Nameamidohydrolase domain containing 1
Synonyms
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93523338-93540033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93527264 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 321 (K321E)
Ref Sequence ENSEMBL: ENSMUSP00000016034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016034]
Predicted Effect probably benign
Transcript: ENSMUST00000016034
AA Change: K321E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000016034
Gene: ENSMUSG00000015890
AA Change: K321E

DomainStartEndE-ValueType
Pfam:Amidohydro_1 78 423 3.6e-21 PFAM
Pfam:Amidohydro_3 107 424 8.5e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Amdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Amdhd1 APN 10 93531568 missense probably benign
IGL02336:Amdhd1 APN 10 93524429 missense probably benign 0.23
IGL02538:Amdhd1 APN 10 93527246 missense probably damaging 0.99
IGL03162:Amdhd1 APN 10 93531475 splice site probably null
R0893:Amdhd1 UTSW 10 93527651 missense probably damaging 1.00
R1857:Amdhd1 UTSW 10 93531554 missense probably damaging 1.00
R4159:Amdhd1 UTSW 10 93534650 missense probably damaging 1.00
R4768:Amdhd1 UTSW 10 93534484 missense possibly damaging 0.88
R4941:Amdhd1 UTSW 10 93531601 missense probably damaging 1.00
R5199:Amdhd1 UTSW 10 93525985 missense probably damaging 1.00
R5917:Amdhd1 UTSW 10 93524470 missense possibly damaging 0.95
R6831:Amdhd1 UTSW 10 93527256 missense probably damaging 0.97
R7100:Amdhd1 UTSW 10 93537074 intron probably null
R7294:Amdhd1 UTSW 10 93534439 missense probably benign 0.09
R7638:Amdhd1 UTSW 10 93534498 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTTCTGCTATGCCCCAGAG -3'
(R):5'- CCATGAAATGTCAGGTGATGCC -3'

Sequencing Primer
(F):5'- ATTTCTGAATCCGAGGCCAG -3'
(R):5'- AATGTCAGGTGATGCCAATGCTC -3'
Posted On2015-01-23