Incidental Mutation 'R2890:Slc25a1'
ID260077
Institutional Source Beutler Lab
Gene Symbol Slc25a1
Ensembl Gene ENSMUSG00000003528
Gene Namesolute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
SynonymsDgsj, 2610100G11Rik, 1300019P08Rik, Slc20a3
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17925223-17928219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17926099 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 251 (L251Q)
Ref Sequence ENSEMBL: ENSMUSP00000003622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003622]
Predicted Effect probably damaging
Transcript: ENSMUST00000003622
AA Change: L251Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003622
Gene: ENSMUSG00000003528
AA Change: L251Q

DomainStartEndE-ValueType
Pfam:Mito_carr 21 116 2.1e-22 PFAM
Pfam:Mito_carr 118 213 9.7e-19 PFAM
Pfam:Mito_carr 216 308 5.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129270
Predicted Effect unknown
Transcript: ENSMUST00000131507
AA Change: L136Q
SMART Domains Protein: ENSMUSP00000123613
Gene: ENSMUSG00000003528
AA Change: L136Q

DomainStartEndE-ValueType
Pfam:Mito_carr 14 99 1.2e-12 PFAM
Pfam:Mito_carr 102 194 5.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193194
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Slc25a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Slc25a1 APN 16 17926066 missense probably damaging 1.00
IGL01940:Slc25a1 APN 16 17926440 missense probably benign 0.00
IGL02076:Slc25a1 APN 16 17927626 missense possibly damaging 0.94
IGL02137:Slc25a1 APN 16 17927370 missense probably benign 0.14
IGL03399:Slc25a1 APN 16 17925820 missense probably damaging 0.97
R0744:Slc25a1 UTSW 16 17927436 missense probably benign 0.04
R0747:Slc25a1 UTSW 16 17926220 missense probably damaging 0.99
R0836:Slc25a1 UTSW 16 17927436 missense probably benign 0.04
R0850:Slc25a1 UTSW 16 17927281 missense probably benign 0.01
R2290:Slc25a1 UTSW 16 17925848 missense possibly damaging 0.92
R6885:Slc25a1 UTSW 16 17927430 missense probably benign 0.00
R7503:Slc25a1 UTSW 16 17926439 nonsense probably null
R7840:Slc25a1 UTSW 16 17926274 missense probably benign 0.00
R7923:Slc25a1 UTSW 16 17926274 missense probably benign 0.00
Z1088:Slc25a1 UTSW 16 17927206 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGCCCTTGTAGAATCTGGGTAG -3'
(R):5'- TGCAACTTACTCCATCCAGG -3'

Sequencing Primer
(F):5'- CCCTTGTAGAATCTGGGTAGAGCAG -3'
(R):5'- TATGAACCCACTGATCACGGGG -3'
Posted On2015-01-23