Incidental Mutation 'R2890:Slc35a5'
ID260078
Institutional Source Beutler Lab
Gene Symbol Slc35a5
Ensembl Gene ENSMUSG00000022664
Gene Namesolute carrier family 35, member A5
Synonyms1010001J06Rik, D730043G07Rik, D16Ertd450e
MMRRC Submission 040478-MU
Accession Numbers

Genbank: NM_028756; MGI: 1921352

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45139573-45158706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45151560 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 114 (C114R)
Ref Sequence ENSEMBL: ENSMUSP00000110247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023344] [ENSMUST00000114600] [ENSMUST00000180636] [ENSMUST00000181177] [ENSMUST00000181750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023344
AA Change: C98R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023344
Gene: ENSMUSG00000022664
AA Change: C98R

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 28 387 1.3e-54 PFAM
low complexity region 424 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114600
AA Change: C114R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110247
Gene: ENSMUSG00000022664
AA Change: C114R

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Nuc_sug_transp 107 155 1.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152364
Predicted Effect probably damaging
Transcript: ENSMUST00000180636
AA Change: C98R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137821
Gene: ENSMUSG00000022664
AA Change: C98R

DomainStartEndE-ValueType
Pfam:UAA 30 196 5.2e-8 PFAM
Pfam:TPT 31 177 3.3e-7 PFAM
Pfam:EamA 73 179 1.2e-7 PFAM
Pfam:Nuc_sug_transp 91 222 7.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181177
SMART Domains Protein: ENSMUSP00000137789
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 30 94 1.1e-12 PFAM
low complexity region 139 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181437
Predicted Effect probably benign
Transcript: ENSMUST00000181750
SMART Domains Protein: ENSMUSP00000137937
Gene: ENSMUSG00000022664

DomainStartEndE-ValueType
transmembrane domain 15 36 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which belongs to subfamily 35A of the solute carrier superfamily. The encoded protein is a nucleoside-sugar transporter. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI

 All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Slc35a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc35a5 APN 16 45152608 nonsense probably null
IGL01012:Slc35a5 APN 16 45143832 missense probably damaging 1.00
IGL01396:Slc35a5 APN 16 45151503 missense probably damaging 1.00
IGL03293:Slc35a5 APN 16 45143781 missense probably damaging 1.00
3-1:Slc35a5 UTSW 16 45143892 missense probably damaging 0.99
R1532:Slc35a5 UTSW 16 45151557 missense probably benign 0.03
R1561:Slc35a5 UTSW 16 45151521 missense possibly damaging 0.93
R1864:Slc35a5 UTSW 16 45143708 missense possibly damaging 0.66
R2086:Slc35a5 UTSW 16 45144265 missense probably damaging 0.99
R2887:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2888:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R2889:Slc35a5 UTSW 16 45151560 missense probably damaging 1.00
R3080:Slc35a5 UTSW 16 45144395 missense probably benign 0.06
R3434:Slc35a5 UTSW 16 45144033 missense probably benign 0.23
R3720:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3722:Slc35a5 UTSW 16 45147322 missense probably damaging 0.99
R3916:Slc35a5 UTSW 16 45158158 intron probably benign
R3917:Slc35a5 UTSW 16 45158158 intron probably benign
R4616:Slc35a5 UTSW 16 45144292 missense probably benign 0.12
R6648:Slc35a5 UTSW 16 45143917 missense probably damaging 1.00
R6881:Slc35a5 UTSW 16 45144080 missense possibly damaging 0.83
R7730:Slc35a5 UTSW 16 45143883 missense probably damaging 0.97
R7832:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
R7915:Slc35a5 UTSW 16 45144207 missense possibly damaging 0.76
R8113:Slc35a5 UTSW 16 45142188 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCAAGTCAGTATTCAGGTGG -3'
(R):5'- CAGAGGCAATTTAATAAAGCCCAG -3'

Sequencing Primer
(F):5'- CAAGTCAGTATTCAGGTGGCTCTAG -3'
(R):5'- GCAATTTAATAAAGCCCAGCTAATAG -3'
Posted On2015-01-23