Incidental Mutation 'R2890:Taf4b'
ID260080
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene NameTATA-box binding protein associated factor 4b
SynonymsTaf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location14783245-14900359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14804792 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 278 (S278P)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
Predicted Effect probably damaging
Transcript: ENSMUST00000169862
AA Change: S278P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: S278P

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8221:Taf4b UTSW 18 14898049 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGTAGCTGCTCAGACTGCTC -3'
(R):5'- TCTGTTGGTCTGAGATAAACAGG -3'

Sequencing Primer
(F):5'- AGACTGCTCTTCCTCCGG -3'
(R):5'- TGGTCTGAGATAAACAGGTCATAAAC -3'
Posted On2015-01-23