Mutagenetix > Incidental Mutation

Incidental Mutation 'R2890:A1cf'

260082

Institutional Source

Beutler Lab

Gene Symbol

A1cf

Ensembl Gene

ENSMUSG00000052595

Gene Name

APOBEC1 complementation factor

Synonyms

apobec-1 complementation factor, ACF, 1810073H04Rik

MMRRC Submission

040478-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R2890 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31868764-31948573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31918017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 167 (I167V)

Ref Sequence

ENSEMBL: ENSMUSP00000153465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]

AlphaFold

Q5YD48

Predicted Effect

probably benign
Transcript: ENSMUST00000075838
AA Change: I167V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: I167V

Domain	Start	End	E-Value	Type
RRM	57	130	2.13e-18	SMART
RRM	137	214	1.59e-8	SMART
RRM	232	299	1.36e-16	SMART
low complexity region	386	411	N/A	INTRINSIC
Pfam:DND1_DSRM	445	523	1.6e-30	PFAM
low complexity region	526	542	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224304
AA Change: I167V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000224400
AA Change: I83V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000224564
AA Change: I167V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224809

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930480E11Rik	A	T	X: 78,370,682	I338F	probably damaging	Het
Adamts20	C	T	15: 94,330,578	R996H	probably benign	Het
Amdhd1	T	C	10: 93,527,264	K321E	probably benign	Het
Baz1a	T	C	12: 54,898,517	H1351R	probably benign	Het
Cep63	T	C	9: 102,618,827	D127G	probably damaging	Het
Chrm5	T	C	2: 112,479,703	Y356C	probably benign	Het
Dock4	A	T	12: 40,623,801		probably null	Het
Dync1h1	T	C	12: 110,616,891	L474P	probably damaging	Het
Fzd7	C	T	1: 59,484,434	A492V	probably benign	Het
Greb1	A	G	12: 16,704,478	L876P	probably damaging	Het
Grik4	T	C	9: 42,671,219	T144A	probably damaging	Het
Gusb	T	C	5: 130,000,502	H146R	probably damaging	Het
Hspg2	T	C	4: 137,549,574	V2835A	probably damaging	Het
Lamp1	T	A	8: 13,173,891	L341H	probably damaging	Het
Lcn10	T	C	2: 25,683,630	L73P	probably damaging	Het
Nostrin	A	G	2: 69,180,905	T347A	probably benign	Het
Olfr1287	A	T	2: 111,449,289	I50F	probably benign	Het
Pcdhb9	G	A	18: 37,403,326	C791Y	probably benign	Het
Phex	T	C	X: 157,310,958	I439V	probably benign	Het
Rbsn	C	T	6: 92,207,123	V70M	possibly damaging	Het
Slc25a1	A	T	16: 17,926,099	L251Q	probably damaging	Het
Slc35a5	A	G	16: 45,151,560	C114R	probably damaging	Het
Srek1ip1	A	T	13: 104,834,250	I70L	probably benign	Het
Taf4b	T	C	18: 14,804,792	S278P	probably damaging	Het
Ttn	T	C	2: 76,896,154		probably benign	Het
Vmn2r13	T	C	5: 109,191,974	D45G	possibly damaging	Het
Vmn2r66	C	T	7: 85,011,819		probably null	Het
Ylpm1	G	T	12: 85,029,813	R646L	probably damaging	Het
Zfp51	C	G	17: 21,463,856	C244W	probably damaging	Het
Zfp619	C	A	7: 39,534,969	T141K	probably benign	Het

Other mutations in A1cf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:A1cf	APN	19	31920951	missense	possibly damaging	0.90
IGL01411:A1cf	APN	19	31911229	missense	possibly damaging	0.94
IGL01445:A1cf	APN	19	31945798	missense	probably benign	0.32
IGL02165:A1cf	APN	19	31927186	missense	possibly damaging	0.92
IGL02543:A1cf	APN	19	31918095	missense	probably damaging	0.97
IGL02651:A1cf	APN	19	31932506	missense	probably benign	0.25
IGL02904:A1cf	APN	19	31934806	missense	probably damaging	1.00
Haywire	UTSW	19	31918124	critical splice donor site	probably null
R0281:A1cf	UTSW	19	31945814	missense	probably benign	0.09
R0349:A1cf	UTSW	19	31932662	missense	possibly damaging	0.62
R0662:A1cf	UTSW	19	31920938	missense	probably benign	0.00
R0697:A1cf	UTSW	19	31911167	missense	probably damaging	1.00
R1055:A1cf	UTSW	19	31932519	missense	probably benign	0.05
R1125:A1cf	UTSW	19	31920978	missense	probably benign	0.00
R1448:A1cf	UTSW	19	31908796	missense	possibly damaging	0.88
R1554:A1cf	UTSW	19	31908902	missense	possibly damaging	0.66
R1616:A1cf	UTSW	19	31934775	missense	probably damaging	0.98
R1660:A1cf	UTSW	19	31893107	nonsense	probably null
R1719:A1cf	UTSW	19	31927126	missense	probably damaging	1.00
R2338:A1cf	UTSW	19	31932545	missense	probably benign
R2435:A1cf	UTSW	19	31920894	missense	probably benign	0.02
R3688:A1cf	UTSW	19	31911169	missense	probably damaging	1.00
R4007:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R4208:A1cf	UTSW	19	31932660	missense	probably benign	0.00
R4448:A1cf	UTSW	19	31945862	missense	probably benign
R5072:A1cf	UTSW	19	31917985	missense	probably benign	0.18
R5491:A1cf	UTSW	19	31918062	missense	possibly damaging	0.57
R5636:A1cf	UTSW	19	31944982	nonsense	probably null
R5932:A1cf	UTSW	19	31893118	missense	possibly damaging	0.68
R7066:A1cf	UTSW	19	31927114	missense	probably damaging	0.99
R7211:A1cf	UTSW	19	31927141	missense	probably benign	0.23
R7413:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R7545:A1cf	UTSW	19	31934790	missense	possibly damaging	0.80
R8020:A1cf	UTSW	19	31893194	missense	probably benign	0.01
R8344:A1cf	UTSW	19	31911119	missense	possibly damaging	0.77
R8497:A1cf	UTSW	19	31945850	missense	probably benign
R8989:A1cf	UTSW	19	31927156	missense	possibly damaging	0.56
R9327:A1cf	UTSW	19	31918099	missense	probably benign	0.12
R9436:A1cf	UTSW	19	31932575	missense	probably benign
Z1176:A1cf	UTSW	19	31918017	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AATGGTCCTGGTACCACAAAAG -3'
(R):5'- ATCAACAGGGACGCTCATGC -3'

Sequencing Primer
(F):5'- GGGGTATGAGTCTATACTGAAACATC -3'
(R):5'- TCATGCCGGGGTCTGCTG -3'

Posted On

2015-01-23