Incidental Mutation 'R2890:A1cf'
ID 260082
Institutional Source Beutler Lab
Gene Symbol A1cf
Ensembl Gene ENSMUSG00000052595
Gene Name APOBEC1 complementation factor
Synonyms apobec-1 complementation factor, ACF, 1810073H04Rik
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2890 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 31868764-31948573 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31918017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 167 (I167V)
Ref Sequence ENSEMBL: ENSMUSP00000153465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]
AlphaFold Q5YD48
Predicted Effect probably benign
Transcript: ENSMUST00000075838
AA Change: I167V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: I167V

DomainStartEndE-ValueType
RRM 57 130 2.13e-18 SMART
RRM 137 214 1.59e-8 SMART
RRM 232 299 1.36e-16 SMART
low complexity region 386 411 N/A INTRINSIC
Pfam:DND1_DSRM 445 523 1.6e-30 PFAM
low complexity region 526 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224304
AA Change: I167V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000224400
AA Change: I83V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000224564
AA Change: I167V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224809
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in A1cf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:A1cf APN 19 31920951 missense possibly damaging 0.90
IGL01411:A1cf APN 19 31911229 missense possibly damaging 0.94
IGL01445:A1cf APN 19 31945798 missense probably benign 0.32
IGL02165:A1cf APN 19 31927186 missense possibly damaging 0.92
IGL02543:A1cf APN 19 31918095 missense probably damaging 0.97
IGL02651:A1cf APN 19 31932506 missense probably benign 0.25
IGL02904:A1cf APN 19 31934806 missense probably damaging 1.00
Haywire UTSW 19 31918124 critical splice donor site probably null
R0281:A1cf UTSW 19 31945814 missense probably benign 0.09
R0349:A1cf UTSW 19 31932662 missense possibly damaging 0.62
R0662:A1cf UTSW 19 31920938 missense probably benign 0.00
R0697:A1cf UTSW 19 31911167 missense probably damaging 1.00
R1055:A1cf UTSW 19 31932519 missense probably benign 0.05
R1125:A1cf UTSW 19 31920978 missense probably benign 0.00
R1448:A1cf UTSW 19 31908796 missense possibly damaging 0.88
R1554:A1cf UTSW 19 31908902 missense possibly damaging 0.66
R1616:A1cf UTSW 19 31934775 missense probably damaging 0.98
R1660:A1cf UTSW 19 31893107 nonsense probably null
R1719:A1cf UTSW 19 31927126 missense probably damaging 1.00
R2338:A1cf UTSW 19 31932545 missense probably benign
R2435:A1cf UTSW 19 31920894 missense probably benign 0.02
R3688:A1cf UTSW 19 31911169 missense probably damaging 1.00
R4007:A1cf UTSW 19 31918124 critical splice donor site probably null
R4208:A1cf UTSW 19 31932660 missense probably benign 0.00
R4448:A1cf UTSW 19 31945862 missense probably benign
R5072:A1cf UTSW 19 31917985 missense probably benign 0.18
R5491:A1cf UTSW 19 31918062 missense possibly damaging 0.57
R5636:A1cf UTSW 19 31944982 nonsense probably null
R5932:A1cf UTSW 19 31893118 missense possibly damaging 0.68
R7066:A1cf UTSW 19 31927114 missense probably damaging 0.99
R7211:A1cf UTSW 19 31927141 missense probably benign 0.23
R7413:A1cf UTSW 19 31918124 critical splice donor site probably null
R7545:A1cf UTSW 19 31934790 missense possibly damaging 0.80
R8020:A1cf UTSW 19 31893194 missense probably benign 0.01
R8344:A1cf UTSW 19 31911119 missense possibly damaging 0.77
R8497:A1cf UTSW 19 31945850 missense probably benign
R8989:A1cf UTSW 19 31927156 missense possibly damaging 0.56
R9327:A1cf UTSW 19 31918099 missense probably benign 0.12
R9436:A1cf UTSW 19 31932575 missense probably benign
Z1176:A1cf UTSW 19 31918017 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATGGTCCTGGTACCACAAAAG -3'
(R):5'- ATCAACAGGGACGCTCATGC -3'

Sequencing Primer
(F):5'- GGGGTATGAGTCTATACTGAAACATC -3'
(R):5'- TCATGCCGGGGTCTGCTG -3'
Posted On 2015-01-23