Incidental Mutation 'R2890:4930480E11Rik'
ID260083
Institutional Source Beutler Lab
Gene Symbol 4930480E11Rik
Ensembl Gene ENSMUSG00000035651
Gene NameRIKEN cDNA 4930480E11 gene
Synonyms
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2890 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location78369643-78371128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78370682 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 338 (I338F)
Ref Sequence ENSEMBL: ENSMUSP00000037594 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000035626
AA Change: I338F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121269
Meta Mutation Damage Score 0.2479 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in 4930480E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:4930480E11Rik APN X 78370019 nonsense probably null
R2888:4930480E11Rik UTSW X 78370682 missense probably damaging 0.99
R2889:4930480E11Rik UTSW X 78370682 missense probably damaging 0.99
R2897:4930480E11Rik UTSW X 78370262 nonsense probably null
R2898:4930480E11Rik UTSW X 78370262 nonsense probably null
R7117:4930480E11Rik UTSW X 78370705 missense probably benign 0.24
R7250:4930480E11Rik UTSW X 78370705 missense probably benign 0.24
R7251:4930480E11Rik UTSW X 78370705 missense probably benign 0.24
R7252:4930480E11Rik UTSW X 78370705 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CCAAGGAGAAGTTTAAACATGGACC -3'
(R):5'- CCAAAGGGTGTCCACTCAATAC -3'

Sequencing Primer
(F):5'- TGGACCATCATACCAGAAAGTG -3'
(R):5'- GGGTGTCCACTCAATACAAATG -3'
Posted On2015-01-23