Incidental Mutation 'R2890:Phex'
ID260084
Institutional Source Beutler Lab
Gene Symbol Phex
Ensembl Gene ENSMUSG00000057457
Gene Namephosphate regulating endopeptidase homolog, X-linked
SynonymsHPDR1
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R2890 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location157162075-157415312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157310958 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 439 (I439V)
Ref Sequence ENSEMBL: ENSMUSP00000122953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079945] [ENSMUST00000138396]
Predicted Effect probably benign
Transcript: ENSMUST00000079945
AA Change: I439V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078863
Gene: ENSMUSG00000057457
AA Change: I439V

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:Peptidase_M13_N 77 479 6.1e-95 PFAM
Pfam:Peptidase_M13 538 748 3.5e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138396
AA Change: I439V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122953
Gene: ENSMUSG00000057457
AA Change: I439V

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:Peptidase_M13_N 77 479 4.2e-116 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane endopeptidase that belongs to the type II integral membrane zinc-dependent endopeptidase family. The protein is thought to be involved in bone and dentin mineralization and renal phosphate reabsorption. Mutations in this gene cause X-linked hypophosphatemic rickets. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Males hemizygous for a null mutation exhibit reduced body size, shortened hindlimbs and tail, osteomalacia, and markedly reduced plasma phosphate levels due to impaired kidney reabsorption. Female heterozygotes exhibit milder symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Phex
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Phex APN X 157177532 missense probably damaging 1.00
IGL02176:Phex APN X 157268493 missense probably damaging 1.00
IGL02501:Phex APN X 157186275 missense probably damaging 1.00
IGL02502:Phex APN X 157183827 missense possibly damaging 0.93
IGL03214:Phex APN X 157177504 missense probably damaging 0.99
IGL03218:Phex APN X 157178787 missense probably damaging 1.00
R0240:Phex UTSW X 157186218 missense probably damaging 1.00
R0240:Phex UTSW X 157186218 missense probably damaging 1.00
R0726:Phex UTSW X 157372561 splice site probably benign
R2888:Phex UTSW X 157310958 missense probably benign 0.00
R2889:Phex UTSW X 157310958 missense probably benign 0.00
Z1177:Phex UTSW X 157409964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGGGGTCATTTGGAAAC -3'
(R):5'- GAACTTGTACTGTCACCACCTTG -3'

Sequencing Primer
(F):5'- CTTCCATCCAAAGAAGTCCT -3'
(R):5'- ACCACCTTGCATCATCTGTTTACAG -3'
Posted On2015-01-23