Incidental Mutation 'R2891:Klf7'
ID260086
Institutional Source Beutler Lab
Gene Symbol Klf7
Ensembl Gene ENSMUSG00000025959
Gene NameKruppel-like factor 7 (ubiquitous)
Synonyms9830124P08Rik
MMRRC Submission 040479-MU
Accession Numbers

Genbank: NM_033563; MGI: 1935151

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2891 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location64029447-64122282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64042362 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 269 (Y269C)
Ref Sequence ENSEMBL: ENSMUSP00000109720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055001] [ENSMUST00000114086]
Predicted Effect probably damaging
Transcript: ENSMUST00000055001
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054674
Gene: ENSMUSG00000025959
AA Change: Y269C

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
ZnF_C2H2 248 272 4.94e-5 SMART
ZnF_C2H2 278 300 6.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114086
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109720
Gene: ENSMUSG00000025959
AA Change: Y269C

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184798
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice die within 3 days of life, showing lack of gastic milk, hypopnea, cyanosis, olfactory bulb hypoplasia, no response to tail clamping, impaired axon projection in the olfactory and visual systems, cerebral cortex and hippocampus, and reduced dendritic branching in the hippocampus. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Clcn6 C T 4: 148,012,616 probably null Het
Farp1 C T 14: 121,256,736 A543V probably damaging Het
Hhat T C 1: 192,595,086 Y355C probably damaging Het
Ireb2 A T 9: 54,899,990 H612L probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Klhl9 T C 4: 88,720,970 I345V probably benign Het
Miga2 A T 2: 30,378,294 probably null Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Ncoa6 T A 2: 155,437,961 D45V possibly damaging Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Shprh T G 10: 11,164,356 S4R probably damaging Het
Taar8a G A 10: 24,077,130 V211I probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Klf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Klf7 APN 1 64042317 missense possibly damaging 0.65
IGL01684:Klf7 APN 1 64120892 splice site probably benign
IGL01844:Klf7 APN 1 64078774 missense probably benign 0.02
IGL03181:Klf7 APN 1 64035726 missense possibly damaging 0.88
Esurientes UTSW 1 64079213 missense possibly damaging 0.78
C9142:Klf7 UTSW 1 64079157 missense possibly damaging 0.47
R1736:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1737:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1744:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R2048:Klf7 UTSW 1 64078754 missense possibly damaging 0.65
R5055:Klf7 UTSW 1 64079280 missense probably benign 0.08
R5613:Klf7 UTSW 1 64042396 missense probably damaging 0.98
R5782:Klf7 UTSW 1 64042411 missense possibly damaging 0.81
R7369:Klf7 UTSW 1 64121141 critical splice acceptor site probably null
R7470:Klf7 UTSW 1 64042313 critical splice donor site probably null
R8501:Klf7 UTSW 1 64079163 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGACCCTGAAACTTTACTAC -3'
(R):5'- ATCTGAGAGGCCATCTGCTG -3'

Sequencing Primer
(F):5'- TTTCACCCTTGCAAGCAGTAGAG -3'
(R):5'- AGGCCATCTGCTGAGACTAG -3'
Posted On2015-01-23