Incidental Mutation 'R2891:Hhat'
ID260088
Institutional Source Beutler Lab
Gene Symbol Hhat
Ensembl Gene ENSMUSG00000037375
Gene Namehedgehog acyltransferase
Synonyms2810432O22Rik, Skn, AP-2CRE, Tg(TFAP2A-cre)1Will
MMRRC Submission 040479-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2891 (G1)
Quality Score215
Status Not validated
Chromosome1
Chromosomal Location192496711-192771223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192595086 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 355 (Y355C)
Ref Sequence ENSEMBL: ENSMUSP00000141575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044190] [ENSMUST00000128619] [ENSMUST00000192585]
Predicted Effect probably damaging
Transcript: ENSMUST00000044190
AA Change: Y355C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046686
Gene: ENSMUSG00000037375
AA Change: Y355C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 5.7e-51 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128619
AA Change: Y355C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120479
Gene: ENSMUSG00000037375
AA Change: Y355C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 3.1e-60 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192585
AA Change: Y355C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141575
Gene: ENSMUSG00000037375
AA Change: Y355C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 2.4e-51 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 'Skinny hedgehog' (SKI1) encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' (see MIM 600725).[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygous null mice display neonatal lethality, holoprosencephaly, short-limb dwarfism, and oligodactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Clcn6 C T 4: 148,012,616 probably null Het
Farp1 C T 14: 121,256,736 A543V probably damaging Het
Ireb2 A T 9: 54,899,990 H612L probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Klf7 T C 1: 64,042,362 Y269C probably damaging Het
Klhl9 T C 4: 88,720,970 I345V probably benign Het
Miga2 A T 2: 30,378,294 probably null Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Ncoa6 T A 2: 155,437,961 D45V possibly damaging Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Shprh T G 10: 11,164,356 S4R probably damaging Het
Taar8a G A 10: 24,077,130 V211I probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Hhat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Hhat APN 1 192717017 missense probably damaging 1.00
IGL02578:Hhat APN 1 192693913 missense probably damaging 0.98
R0420:Hhat UTSW 1 192552934 splice site probably null
R0842:Hhat UTSW 1 192726331 missense probably benign 0.07
R1794:Hhat UTSW 1 192693906 nonsense probably null
R1978:Hhat UTSW 1 192717107 missense probably benign 0.03
R2073:Hhat UTSW 1 192727379 missense possibly damaging 0.94
R2571:Hhat UTSW 1 192553022 missense probably damaging 1.00
R4685:Hhat UTSW 1 192595054 missense probably damaging 1.00
R4781:Hhat UTSW 1 192686979 intron probably benign
R4988:Hhat UTSW 1 192657294 intron probably benign
R5002:Hhat UTSW 1 192543190 missense probably benign 0.23
R5018:Hhat UTSW 1 192595038 missense probably damaging 1.00
R5023:Hhat UTSW 1 192727339 missense probably damaging 1.00
R5695:Hhat UTSW 1 192717019 missense probably damaging 0.99
R6151:Hhat UTSW 1 192759757 missense probably damaging 1.00
R6239:Hhat UTSW 1 192595087 missense probably damaging 1.00
R7007:Hhat UTSW 1 192693826 missense possibly damaging 0.51
R7079:Hhat UTSW 1 192553046 missense possibly damaging 0.95
R7534:Hhat UTSW 1 192726304 missense probably damaging 1.00
R8783:Hhat UTSW 1 192513937 missense probably damaging 1.00
Z1177:Hhat UTSW 1 192661492 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTTACCAAAGTCTCCCGGAC -3'
(R):5'- TTAACCTAAAGCCACTCCCTGTG -3'

Sequencing Primer
(F):5'- ACACAGGGTGTCTCTAGCAG -3'
(R):5'- TTTGTCAACAATGAGTGAAGTGG -3'
Posted On2015-01-23