Incidental Mutation 'R2891:Rapsn'
ID260091
Institutional Source Beutler Lab
Gene Symbol Rapsn
Ensembl Gene ENSMUSG00000002104
Gene Namereceptor-associated protein of the synapse
SynonymsNraps, rapsyn, 43kDa acetylcholine receptor-associated protein, Raps
MMRRC Submission 040479-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2891 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91035620-91045729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91036824 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 157 (D157V)
Ref Sequence ENSEMBL: ENSMUSP00000107073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050323] [ENSMUST00000111445] [ENSMUST00000111446]
Predicted Effect probably damaging
Transcript: ENSMUST00000050323
AA Change: D157V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054150
Gene: ENSMUSG00000002104
AA Change: D157V

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 2e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
Blast:TPR 246 279 1e-14 BLAST
TPR 286 319 2.07e1 SMART
RING 363 402 2.67e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111445
AA Change: D157V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107072
Gene: ENSMUSG00000002104
AA Change: D157V

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
RING 304 343 2.67e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111446
AA Change: D157V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107073
Gene: ENSMUSG00000002104
AA Change: D157V

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
Blast:TPR 193 226 9e-15 BLAST
TPR 233 266 2.07e1 SMART
RING 310 349 2.67e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of acetylcholine receptor clusters at end plate band of neuromuscular synapses, muscle weakness, and respiratory distress leading to lethality within hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Clcn6 C T 4: 148,012,616 probably null Het
Farp1 C T 14: 121,256,736 A543V probably damaging Het
Hhat T C 1: 192,595,086 Y355C probably damaging Het
Ireb2 A T 9: 54,899,990 H612L probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Klf7 T C 1: 64,042,362 Y269C probably damaging Het
Klhl9 T C 4: 88,720,970 I345V probably benign Het
Miga2 A T 2: 30,378,294 probably null Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Ncoa6 T A 2: 155,437,961 D45V possibly damaging Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Shprh T G 10: 11,164,356 S4R probably damaging Het
Taar8a G A 10: 24,077,130 V211I probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Rapsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rapsn APN 2 91035860 missense probably damaging 1.00
IGL01386:Rapsn APN 2 91036799 missense probably damaging 1.00
IGL01517:Rapsn APN 2 91036618 missense probably damaging 1.00
IGL01707:Rapsn APN 2 91043240 missense probably benign 0.03
IGL02322:Rapsn APN 2 91041906 missense possibly damaging 0.80
IGL02800:Rapsn APN 2 91043239 missense probably benign
rasputin UTSW 2 91035924 missense probably damaging 1.00
R0744:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0833:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0836:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R1224:Rapsn UTSW 2 91043198 missense probably damaging 1.00
R1294:Rapsn UTSW 2 91036775 nonsense probably null
R1619:Rapsn UTSW 2 91043159 missense possibly damaging 0.84
R2892:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2893:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R4135:Rapsn UTSW 2 91036817 missense probably damaging 0.99
R4515:Rapsn UTSW 2 91043212 missense possibly damaging 0.91
R5689:Rapsn UTSW 2 91035924 missense probably damaging 1.00
R5860:Rapsn UTSW 2 91045514 missense probably damaging 1.00
R5953:Rapsn UTSW 2 91041963 missense probably benign 0.04
R6495:Rapsn UTSW 2 91036628 missense probably damaging 1.00
R7644:Rapsn UTSW 2 91041954 missense possibly damaging 0.80
R7775:Rapsn UTSW 2 91044948 missense probably benign 0.02
R7778:Rapsn UTSW 2 91044948 missense probably benign 0.02
R7896:Rapsn UTSW 2 91044955 missense probably benign 0.06
X0064:Rapsn UTSW 2 91043003 missense probably benign 0.14
Z1176:Rapsn UTSW 2 91036598 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CGCAGCAATGAGAAGCTATGTG -3'
(R):5'- GAACTTTTGGCCAGAGAAAGTC -3'

Sequencing Primer
(F):5'- TGAGAAGCTATGTGAGTTCCAC -3'
(R):5'- TCTCAGGGAGCCTCAAATC -3'
Posted On2015-01-23