Mutagenetix > Incidental Mutation

Incidental Mutation 'R2891:Clcn6'

260094

Institutional Source

Beutler Lab

Gene Symbol

Clcn6

Ensembl Gene

ENSMUSG00000029016

Gene Name

chloride channel, voltage-sensitive 6

Synonyms

MMRRC Submission

040479-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R2891 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

148088716-148123270 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 148097073 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]

AlphaFold

O35454

Predicted Effect

probably null
Transcript: ENSMUST00000030879

SMART Domains

Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	138	571	5.5e-98	PFAM
CBS	609	658	1.68e-3	SMART
CBS	811	859	1.34e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105711

SMART Domains

Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.5e-98	PFAM
CBS	612	661	1.68e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000137724

SMART Domains

Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.9e-101	PFAM
CBS	612	661	1.68e-3	SMART
CBS	814	862	1.34e-11	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	C	5: 81,841,366 (GRCm39)	Y816H	probably damaging	Het
Farp1	C	T	14: 121,494,148 (GRCm39)	A543V	probably damaging	Het
Hhat	T	C	1: 192,277,394 (GRCm39)	Y355C	probably damaging	Het
Ireb2	A	T	9: 54,807,274 (GRCm39)	H612L	probably benign	Het
Kcnj3	A	T	2: 55,337,027 (GRCm39)	I298F	probably damaging	Het
Kdr	A	G	5: 76,107,496 (GRCm39)	F1016L	probably damaging	Het
Klf7	T	C	1: 64,081,521 (GRCm39)	Y269C	probably damaging	Het
Klhl9	T	C	4: 88,639,207 (GRCm39)	I345V	probably benign	Het
Miga2	A	T	2: 30,268,306 (GRCm39)		probably null	Het
Nadk	A	G	4: 155,671,817 (GRCm39)	N232S	possibly damaging	Het
Ncoa6	T	A	2: 155,279,881 (GRCm39)	D45V	possibly damaging	Het
Pcnx2	A	G	8: 126,617,797 (GRCm39)	S153P	probably damaging	Het
Per2	C	A	1: 91,373,325 (GRCm39)	Q154H	probably damaging	Het
Pik3ap1	G	A	19: 41,364,500 (GRCm39)	A73V	probably benign	Het
Plod3	G	C	5: 137,017,000 (GRCm39)	A50P	probably benign	Het
Rapsn	A	T	2: 90,867,169 (GRCm39)	D157V	probably damaging	Het
Shprh	T	G	10: 11,040,100 (GRCm39)	S4R	probably damaging	Het
Taar8a	G	A	10: 23,953,028 (GRCm39)	V211I	probably benign	Het
Vpreb3	C	T	10: 75,779,056 (GRCm39)		probably benign	Het

Other mutations in Clcn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Clcn6	APN	4	148,102,359 (GRCm39)	critical splice donor site	probably null
IGL00434:Clcn6	APN	4	148,098,195 (GRCm39)	missense	probably damaging	1.00
IGL00973:Clcn6	APN	4	148,098,245 (GRCm39)	splice site	probably benign
IGL01384:Clcn6	APN	4	148,103,423 (GRCm39)	missense	probably damaging	1.00
IGL01465:Clcn6	APN	4	148,105,908 (GRCm39)	splice site	probably benign
IGL01522:Clcn6	APN	4	148,101,992 (GRCm39)	missense	probably benign	0.44
R0194:Clcn6	UTSW	4	148,097,213 (GRCm39)	missense	probably damaging	1.00
R0280:Clcn6	UTSW	4	148,093,172 (GRCm39)	missense	probably damaging	1.00
R0349:Clcn6	UTSW	4	148,108,651 (GRCm39)	missense	possibly damaging	0.89
R0352:Clcn6	UTSW	4	148,099,063 (GRCm39)	missense	probably damaging	1.00
R0586:Clcn6	UTSW	4	148,123,206 (GRCm39)	unclassified	probably benign
R0927:Clcn6	UTSW	4	148,113,849 (GRCm39)	missense	probably benign	0.30
R1141:Clcn6	UTSW	4	148,098,356 (GRCm39)	missense	probably damaging	0.99
R1465:Clcn6	UTSW	4	148,098,358 (GRCm39)	missense	probably damaging	1.00
R1465:Clcn6	UTSW	4	148,098,358 (GRCm39)	missense	probably damaging	1.00
R1473:Clcn6	UTSW	4	148,108,613 (GRCm39)	missense	possibly damaging	0.93
R1551:Clcn6	UTSW	4	148,097,235 (GRCm39)	missense	possibly damaging	0.74
R1571:Clcn6	UTSW	4	148,097,226 (GRCm39)	missense	possibly damaging	0.63
R1593:Clcn6	UTSW	4	148,099,051 (GRCm39)	missense	probably benign
R1596:Clcn6	UTSW	4	148,107,836 (GRCm39)	missense	probably damaging	1.00
R1706:Clcn6	UTSW	4	148,102,025 (GRCm39)	missense	probably benign	0.00
R1769:Clcn6	UTSW	4	148,098,758 (GRCm39)	splice site	probably null
R2021:Clcn6	UTSW	4	148,095,109 (GRCm39)	critical splice donor site	probably null
R2022:Clcn6	UTSW	4	148,095,109 (GRCm39)	critical splice donor site	probably null
R2049:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2081:Clcn6	UTSW	4	148,095,525 (GRCm39)	missense	probably damaging	1.00
R2140:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2141:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2142:Clcn6	UTSW	4	148,108,594 (GRCm39)	missense	possibly damaging	0.88
R2177:Clcn6	UTSW	4	148,099,057 (GRCm39)	missense	possibly damaging	0.73
R2511:Clcn6	UTSW	4	148,101,951 (GRCm39)	critical splice donor site	probably null
R3750:Clcn6	UTSW	4	148,108,644 (GRCm39)	nonsense	probably null
R4014:Clcn6	UTSW	4	148,102,067 (GRCm39)	missense	probably damaging	0.98
R4023:Clcn6	UTSW	4	148,098,740 (GRCm39)	missense	possibly damaging	0.91
R4024:Clcn6	UTSW	4	148,098,740 (GRCm39)	missense	possibly damaging	0.91
R4025:Clcn6	UTSW	4	148,098,740 (GRCm39)	missense	possibly damaging	0.91
R4667:Clcn6	UTSW	4	148,108,624 (GRCm39)	missense	possibly damaging	0.61
R4865:Clcn6	UTSW	4	148,104,223 (GRCm39)	missense	probably damaging	1.00
R4978:Clcn6	UTSW	4	148,093,227 (GRCm39)	missense	probably benign	0.05
R5140:Clcn6	UTSW	4	148,122,774 (GRCm39)	unclassified	probably benign
R5345:Clcn6	UTSW	4	148,123,206 (GRCm39)	unclassified	probably benign
R5467:Clcn6	UTSW	4	148,102,093 (GRCm39)	missense	possibly damaging	0.81
R5665:Clcn6	UTSW	4	148,099,018 (GRCm39)	missense	possibly damaging	0.71
R5739:Clcn6	UTSW	4	148,098,646 (GRCm39)	missense	probably damaging	1.00
R5899:Clcn6	UTSW	4	148,102,049 (GRCm39)	missense	probably benign	0.01
R6043:Clcn6	UTSW	4	148,093,245 (GRCm39)	missense	probably damaging	1.00
R6351:Clcn6	UTSW	4	148,101,957 (GRCm39)	missense	probably benign	0.01
R6593:Clcn6	UTSW	4	148,095,226 (GRCm39)	missense	probably benign	0.21
R7440:Clcn6	UTSW	4	148,098,652 (GRCm39)	missense	probably damaging	1.00
R7674:Clcn6	UTSW	4	148,097,151 (GRCm39)	missense	probably damaging	1.00
R7756:Clcn6	UTSW	4	148,113,896 (GRCm39)	missense	probably damaging	1.00
R7901:Clcn6	UTSW	4	148,095,202 (GRCm39)	missense	probably damaging	1.00
R8559:Clcn6	UTSW	4	148,111,032 (GRCm39)	missense	possibly damaging	0.88
R8747:Clcn6	UTSW	4	148,093,354 (GRCm39)	critical splice donor site	probably null
R9246:Clcn6	UTSW	4	148,113,866 (GRCm39)	missense	probably benign	0.25
R9343:Clcn6	UTSW	4	148,098,458 (GRCm39)	missense	probably benign	0.03
V7732:Clcn6	UTSW	4	148,098,412 (GRCm39)	missense	probably damaging	0.96
Z1177:Clcn6	UTSW	4	148,107,827 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCTTACGCTTGTACATGG -3'
(R):5'- GTGACATCATGGAGCCCAAC -3'

Sequencing Primer
(F):5'- GGCAAATAATTAATACCAAGTCTGC -3'
(R):5'- TGGAGCCCAACCTGACGTAC -3'

Posted On

2015-01-23