Incidental Mutation 'R2891:Taar8a'
ID260102
Institutional Source Beutler Lab
Gene Symbol Taar8a
Ensembl Gene ENSMUSG00000096442
Gene Nametrace amine-associated receptor 8A
SynonymsLOC215859
MMRRC Submission 040479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2891 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24076500-24077534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24077130 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 211 (V211I)
Ref Sequence ENSEMBL: ENSMUSP00000062719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051133]
Predicted Effect probably benign
Transcript: ENSMUST00000051133
AA Change: V211I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062719
Gene: ENSMUSG00000096442
AA Change: V211I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 244 3.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 42 327 7.1e-15 PFAM
Pfam:7tm_1 48 312 9.1e-58 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Clcn6 C T 4: 148,012,616 probably null Het
Farp1 C T 14: 121,256,736 A543V probably damaging Het
Hhat T C 1: 192,595,086 Y355C probably damaging Het
Ireb2 A T 9: 54,899,990 H612L probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Klf7 T C 1: 64,042,362 Y269C probably damaging Het
Klhl9 T C 4: 88,720,970 I345V probably benign Het
Miga2 A T 2: 30,378,294 probably null Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Ncoa6 T A 2: 155,437,961 D45V possibly damaging Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Shprh T G 10: 11,164,356 S4R probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Taar8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Taar8a APN 10 24076861 missense probably damaging 1.00
IGL01546:Taar8a APN 10 24076915 missense possibly damaging 0.95
IGL01597:Taar8a APN 10 24076858 missense possibly damaging 0.96
IGL02387:Taar8a APN 10 24077362 missense possibly damaging 0.93
IGL02815:Taar8a APN 10 24077380 missense probably benign 0.02
R0762:Taar8a UTSW 10 24077077 missense probably benign 0.34
R1690:Taar8a UTSW 10 24076915 missense probably damaging 1.00
R3889:Taar8a UTSW 10 24077025 missense probably benign 0.00
R3962:Taar8a UTSW 10 24077156 missense probably damaging 0.99
R4090:Taar8a UTSW 10 24077164 missense probably damaging 0.96
R6580:Taar8a UTSW 10 24076893 missense probably damaging 0.99
R6605:Taar8a UTSW 10 24076776 missense possibly damaging 0.88
R7422:Taar8a UTSW 10 24076864 missense probably damaging 1.00
R7571:Taar8a UTSW 10 24077408 nonsense probably null
R8265:Taar8a UTSW 10 24076941 missense probably damaging 1.00
X0022:Taar8a UTSW 10 24077508 missense possibly damaging 0.93
X0062:Taar8a UTSW 10 24077381 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATCTCCTGGATTCTGCC -3'
(R):5'- GTGATGAAGCCCATGAAAGC -3'

Sequencing Primer
(F):5'- GGATTCTGCCCCTGGTGTAC -3'
(R):5'- GCATCAACCAATGCGTCAATTGTG -3'
Posted On2015-01-23